Insect viruses capable of killing at least one target insect pest quicker than previously described viruses and DNA sequence conferring that phenotype of faster killing are provided. Further improvement in the speed of killing is obtained when the virus of this invention also contains a nonfunctional egt gene to reduce feeding by the infected larvae, inhibit growth and further mediate the earlier death of the infected insect. A specifically exemplified faster-killing insect virus is the V-8 strain of AcMNPV. The faster killing phenotype is carried on a MluI to EspI fragment from 1.93 to 3.27 map units within the AcMNPV genome, and its sequence is provided herein as SEQ ID NO: 3 . . . V8vEGTDEL is the egt-inactivated derivative of AcMNPV V-8; the combination of the increased virulence of the V-8 genotype, for example, and the inactivation of the gene encoding ecdysteroid glycosyl transferase provides further improvement (as further decrease in time after infection until insect death). Additionally, such an Egt-deficient baculovirus may be still further modified to express a protein which affects ecdysis. Methods for producing the faster-killing insect virus, improved insecticidal compositions and improved methods of controlling insects are also included within the scope of this invention.

Current U.S. Class:	424/93.2 ; 424/93.6; 435/235.1; 435/320.1
Current International Class:	A01N 25/26 (20060101); A01N 63/02 (20060101); A01N 63/00 (20060101); A01N 63/04 (20060101); C07K 14/01 (20060101); C07K 14/005 (20060101); A01N 063/00 (); C12N 007/01 ()
Field of Search:	435/69.1,172.1,172.3,320.1,235.1 536/23.1,23.72 424/93.2,93.6

Greenlee, Winner and Sullivan, P.C.

---

Claims

---

We claim:

1. An isolated and purified recombinant Autographa californica Nuclear Polyhedrosis Virus (AcMNPV) having incorporated within its genome a segment of heterologous insect virus DNA derived from Rachiplusia ou Nuclear Polyhedrosis Virus, said segment of DNA conferring improved and faster killing properties as reflected in a lower LT.sub.50 value for at least one insect pest as compared with an isogenic parental AcMNPV lacking said segment of DNA, and wherein said segment of DNA comprises a V-8 nucleotide sequence as given in SEQ ID NO:3, from nucleotide 534 to nucleotide 1763.

2. The recombinant AcMNPV of claim 1 wherein said DNA segment comprises a nucleotide sequence as given in SEQ ID NO:3. from nucleotide 1 to nucleotide 1763.

3. The recombinant AcMNPV of claim 2 which is AcMNPV V-8.

4. The recombinant AcMNPV of claim 1 which is VEcoRIHybI or VEcoRIHybIFS.

5. An insecticidal composition comprising a recombinant AcMNPV of claim 1 and a suitable carrier.

6. The insecticidal composition of claim 5 wherein said recombinant AcMNPV has been genetically engineered to inactivate a gene encoding ecdysteroid UDP-glycosyltransferase.

7. The insecticidal composition of claim 6 wherein said recombinant AcMNPV is at least one of AcMNPV V-8 and V8vEGTDEL.

---

Description

---

TECHNICAL FIELD

The present invention relates to methods and compositions using baculoviruses and sequences therefrom for improved biological control of insect pests. More particularly, the present invention relates to a recombinant baculovirus which has improved properties in insect control and the segment therefrom conferring improved properties, i.e., more rapid death for at least one target insect. The present invention also relates to genetically modified baculoviruses with further improved killing properties and methods of use.

BACKGROUND OF THE INVENTION

Interest in the biological control of insect pests has arisen as a result of disadvantages of conventional chemical pesticides. Chemical pesticides generally affect beneficial as well as nonbeneficial species. Insect pests tend to acquire resistance to such chemicals so that new insect pest populations can rapidly develop that are resistant to these pesticides. Furthermore, chemical residues pose environmental hazards and possible health concerns. Biological control presents an alternative means of pest control which can reduce dependence on chemical pesticides.

The primary strategies for biological control include the deployment of naturally-occurring organisms which are pathogenic to insects (entomopathogens) and the development of crops that are more resistant to insect pests. Approaches include the identification and characterization of insect genes or gene products which may serve as suitable targets for insect control agents, the identification and exploitation of previously unused microorganisms (including the modification of naturally-occurring nonpathogenic microorganisms to render them pathogenic to insects), the modification and refinement of currently used entomopathogens, and the development of genetically engineered crops which display greater resistance to insect pests.

Viruses that cause natural epizootic diseases within insect populations are among the entomopathogens which have been developed as biological pesticides. Baculoviruses are a large group of viruses which infect only arthropods (Miller, L. K. (1981) in Genetic Engineering in the Plant Sciences, N. Panopoulous, (ed.), Praeger Publ., New York, pp. 203-224; Carstens, (1980) Trends in Biochemical Science 52:107-110; Harrap and Payne (1979) in Advances in Virus Research, Vol. 25, Lawfer et al. (eds.), Academic Press, New York, pp. 273-355; The Biology of Baculoviruses, Vol. I and II, Granados and Federici (eds.), CRC Press, Boca Raton, Fla., 1986.). Many baculoviruses infect insects which are pests of commercially important agricultural and forestry crops. Such baculoviruses are potentially valuable as biological control agents. Four different baculoviruses have been registered for use as insecticides by the U.S. Environmental Protection Agency. Among the advantages of baculoviruses as biological pesticides is their host specificity. Not only do baculoviruses as a group infect only arthropods, but also individual baculovirus strains usually only infect one or a few species of insects. Thus, they pose no risk to man or the environment, and can be used without adversely affecting beneficial insect species.

Baculoviruses, including AcMNPV, have been found in approximately 400 different species across several different insect orders; the vast majority of these viruses occur in the order Lepidoptera. Baculoviruses are known to infect insects in both natural ecosystems (e.g., forests and prairies) and monocultural agroecosystems (e.g., cotton fields).

Autographa californica nuclear polyhedrosis virus, (AcMNPV) is the most extensively characterized baculovirus known. AcMNPV belongs to the family Baculoviridae, subfamily Eubaculovirinae, genus Nuclear Polyhedrosis Virus, and the subgenus Multiple Nucleocapsid Virus, which are characterized by the formation of viral occlusion bodies (or polyhedra) in the nuclei of infected host cells. The virus was first isolated more than 20 years ago from an alfalfa looper, Autographa californica, during a naturally occurring epizootic infection in California. Since then, the virus has been characterized extensively using biochemical and molecular techniques, and extensive DNA sequence within the 128 kbp genome is known. AcMNPV has been designated as the type species for the subgenus Multiple Nucleocapsid Virus.

Baculovirus subgroups include nuclear polyhedrosis viruses (NPV), granulosis viruses (GV), and non-occluded baculoviruses. In the occluded forms of baculoviruses (GV and NPV), the virions (enveloped nucleocapsids) are embedded in a crystalline protein matrix. This structure, referred to as an inclusion or occlusion body, is the form found extraorganismally in nature and is responsible for spreading the infection between organisms. The characteristic feature of the NPVs is that many virions are embedded in each occlusion body. The NPV occlusion bodies are relatively large (up to 5 micrometers). Occlusion bodies of the GV viruses are smaller and contain a single virion each. The crystalline protein matrix of the occlusion bodies of both forms is primarily composed of a single 25,000 to 33,000 dalton polypeptide which is known as polyhedrin or granulin. Baculoviruses of the non-occluded subgroup do not produce a polyhedrin or granulin protein, and do not form occlusion bodies.

In nature, infection is initiated when an insect ingests food contaminated with baculovirus particles, typically in the form of occlusion bodies for an NPV such as AcMNPV. The occlusion bodies dissociate under the alkaline conditions of the insect midgut, releasing individual virus particles which then invade epithelial cells lining the gut. Within a host cell, the baculovirus migrates to the nucleus where replication takes place. Initially, certain specific viral proteins are produced within the infected cell via the transcription and translation of so-called "early genes." Among other functions, these proteins are required to allow replication of the viral DNA, which begins 4 to 6 hours after the virus enters the cell. Extensive viral DNA replication proceeds up to about 24 hours post-infection (pi). From about 8 to 20 hours pi, the infected cell produces large amounts of "late viral gene products." These include components of the nucleocapsid which surrounds the viral DNA during the formation of progeny virus particles. Production of the progeny virus particles begins around 12 hours pi. Initially, progeny virus migrate to the cell membrane where they acquire an envelope as they bud out from the surface of the cell. This non-occluded virus can then infect other cells within the insect. Polyhedrin synthesis begins about 18 hours after infection and increases to very high levels by 24 hours pi. At that time, there is a decrease in the number of budded virus particles, and progeny virus are then embedded in occlusion bodies. Occlusion body formation continues until the cell dies or lyses. Some baculoviruses infect virtually every tissue in the host insect so that at the end of the infection process, the entire insect is liquified, releasing extremely large numbers of occlusion bodies which can them spread the infection to other insects. (Reviewed in The Biology of Baculoviruses, Vol. I and II, Granados and Federici (eds.), CRC Press, Boca Raton, Fla., 1986.)

Larvae become increasingly resistant to viral infection as they grow and mature. Both adult tissues and pupal tissues appear to be refractory to viral infection. The primary means of infection by AcMNPV appears to be via horizontal transmission. Insects typically acquire AcMNPV by consuming contaminated food. The occlusions dissolve in the insect mid-gut and release virions which establish a primary site of infection in mid-gut cells.

The ability of AcMNPV to persist and spread in the environment is governed by many interrelated factors (reviewed by Evans, H. (1986) The Biology of Baculoviruses, Ecology and Epizoology of Baculoviruses, Granados, R. R. and. Federici, B. A. (eds.) pp.89-132). Factors such as the relative sensitivity of the insect host to virus, as well as developmentally determined sensitivity to AcMNPV, are important. Host density also appears to play an important role in determining persistence and spread of baculoviruses. There are important implications concerning the role of biotic and abiotic forces that determine AcMNPV environmental transmission and persistence. For example, predators compete with virus for available insect hosts and tend to reduce potentlal virus productivity by removal of these virus-susceptible hosts from the environment. On the other hand, predators can also indirectly increase the survival capacity and spread of MNPVs by increasing virus dispersal and by making more efficient use of available host populations. This predator-aided transmission is generally by passage of infectious MNPVs through the gut of predatory insects, birds, and mammals. Likewise, abiotic factors (such as ultraviolet (UV) light, rainfall, temperature, and pH) have a major influence on virus survival and spread in the environment. For example, baculoviruses appear to be particularly sensitive to UV irradiation and to alkaline pH. Persistence of field applied virus without UV protection can be as little as 1-2 days in the field. Soil appears to be a particularly important reservoir for persistence of baculoviruses. The decline of viruses in the soil is slow and wide range of times for persistence and viability have been reported. The ubiquitous and harmless association between baculoviruses and humans and other species due to dietary exposure underscores their safety and value as insecticides.

One potential disadvantage to using baculoviruses as pesticides is the length of time between virus ingestion and insect death. During this time, the pest insect continues to feed and damage crops. Because pesticides are generally applied only after an infestation is apparent, it is critical that the time of feeding be minimized. One approach to lessening insect feeding time in insect control via viral infection is the use of ecdysteroid glucosyl transferase-deficient baculovirus (O'Reilly and Miller (1991) Biotechnology 9:1086-1089; U.S. Pat. No. 5,180,581, Miller and O'Reilly; U.S. patent application Ser. No. 07/656,179, allowed, all of which are incorporated by reference). Other approaches include the insertion of genes encoding insect toxins or hormones into the viral genome (Hammock et al. (1993) Arch. Insect Biochem. Physiol. 22:315-344; McCutchen et al. (1991) Bio/Technology 9:848-852; Tomalski and Miller (1991) Nature 352:82-85; Tomalski and Miller (1992) Bio/Technology 10:545-549 and Stewart et al. (1991) Nature 352:85-88). Another approach is the incorporation of an insect-specific paralytic neurotoxin gene into a baculovirus genome (see, e.g., U.S. Pat. No. 5,266,317, issued Nov. 30, 1993, Tomalski and Miller, which discloses insect-predacious mite toxins; U.S. patent application Ser. No. 08/009,625, filed Jan. 29, 1993; Canadian Patent Application 2,005,658, Zlotkin et al.; Zlotkin et al. (1971) Toxin 9:1-8, which disclose Androctonus australis toxin sequences).

There is a need for biological pesticides, specifically insect viruses, which reduce feeding by the insect before death and/or which result in a shorter time between infection and death when compared to prior art insect viruses. A biological pesticide is preferred because it creates less of an environmental hazard than a chemical pesticide. The exploitation of a recombinant insect which results in more rapid insect killing than available viruses will allow improved biological control of insect pests.

SUMMARY OF THE INVENTION

This invention specifically provides a purified and isolated recombinant baculovirus (called AcMNPV V-8 herein) which has improved killing properties as compared with prior art Autographa californica Nuclear Polyhedrosis Virus strains, against at least one insect pest including, but not limited to, Spodoptera fruqiperda. The object baculovirus has been deposited with the American Type Culture Collection as ATCC VR-2465 (American Type Culture Collection, 12301 Parklawn Drive, Rockville, Md.). Improved killing properties against at least one insect pest means that when at least one species of insect pest is infected, the time between infection and insect death is shorter than with a comparison AcMNPV, e.g., AcMNPV E2 (ATCC VR-1344).

A further specific object of the present invention is an AcMNPV V-8 derivative which has been genetically engineered to inactivate the gene encoding ecdysteroid glucosyltransferase (egt). A preferred embodiment is V8vEGTDEL, which is the AcMNPV V-8 derivative in which a portion of egt is deleted, with the result that a functional ecdysteroid glucosyltransferase is not produced during the viral infection process.

An additional object of the present invention is a segment of insect virus DNA which confers the improved (i.e., faster) killing phenotype when incorporated in the genome of a heterologous insect virus. As specifically exemplified such a DNA fragment is the MluI to EspI fragment from the region of the AcMNPV V-8 genome of 1.93 to 3.27 map units (or from the V1000 nuclear polyhedrosis virus, which appears to be closely related to or identical to Rachiplusia ou Nuclear Polyhedrosis Virus); the DNA sequence of the exemplified V-8 fragment is given in FIG. 4 (SEQ ID NO:3). This DNA segment carries sequences encoding a late expression factor (lef-2), and polypeptide of 603 amino acids (function unknown) and sequences upstream of the polyhedrin gene. Within this MluI to EspI fragment of the V-8 is a smaller region which is capable of conferring the improved killing phenotype when incorporated into the genome of a (recombinant) AcMNPV; this smaller region is between nucleotide 3026 and 4231 (V-8 sequence) of FIG. 4 which corresponds to nucleotides 194 to 856 of SEQ ID NO:3. Also within the scope of the invention are other recombinant insect viruses, including baculoviruses, in which such a DNA fragment conferring the improved killing phenotype has been incorporated into the genome with the result that at least one insect pest is killed quicker after infection than the corresponding baculovirus which has not been so genetically engineered or which otherwise does not contain a related heterologous DNA segment which confers increased virulence.

The present invention also provides methods for improving the killing properties of a baculovirus by introducing a segment of DNA conferring a phenotype of improved killing, e.g., faster insect death of at least one species of insect pest after infection, e.g., and by confirming the improved killing property by determining that the LT.sub.50 (time required for killing 50% of test larvae at a standard virus dose, using a dose killing 90% of test larvae by set time post infection) is shorter for the genetically engineered strain than for the parental baculovirus. The genetically engineered strain may be produced by molecular biological techniques using an insect virus selected from the group consisting of nuclear polyhedrosis viruses including, but not limited to, Lymantria dispar NPV, Autographa californica NPV, Synographa falcifera NPV, Spodoptera lilturalis NPV, Spodoptera exigua NPV, Spodoptera frugiperda NPV, Heliothis armigera NPV, Mamestra brassicae NPV, Choristoneura fumiferana NPV, Trichoplusia ni NPV, Helicoverpa zea NPV and Manduca sexta NPV; granulosis viruses including, but not limited to, Cydia pomonella GV, Pieris brassicae GV and Trichoplusia ni GV. Non-occluded viruses from the Baculovirinae may also be genetically modified to improve their killing properties for particular target insects; examples of such non-occluded baculovirinae include, but are not limited to, those of Orcytes rhinoceros and Heliothis zea non-occluded baculovirinae. Functionally equivalent sequences conferring improved killing properties may be isolated from viruses other than as specifically exemplified herein, and incorporated into viral genomes which do not naturally contain them to produce insect viruses with improved insect control properties.

Alternatively it may be produced by co-infection of a first baculovirus with a second baculovirus whose genome comprises said DNA fragment, wherein said first and second baculoviruses are sufficiently related (i.e., have sufficient DNA sequence identity at least over limited distances on regions flanking the sequences conferring the improved killing phenotype) so that recombination occurs to result in a recombinant baculovirus being produced which incorporates the DNA conferring the improved killing phenotype.

Further objects of the present invention are insecticidal compositions comprising the baculoviruses with improved killing properties against at least one insect pest. Preferred viruses include V8vEGTDEL, AcMNPV V-8, vEcoRIhybI, vEcoRIHybIFS and nuclear polyhedrosis viruses and granulosis viruses and non-occluded baculovirinae viruses in a non-limiting fashion as set forth herein above into which a segment of DNA conferring the improved killing phenotype has been genetically engineered or incorporated by recombination. Preferred the insecticidal compositions of the present invention are formulated as wettable powders. The composition of a preferred wettable powder insecticidal composition is as follows:

______________________________________ Ingredient Nominal Percent (w/w) ______________________________________ V8vEGTDEL polyhedrin 10.0% inclusion bodies Morwet D425 30.0% Morewet EFW 20.0% Kaolin Clay 16.0% Microcel E 16.0% UV-9 oxybenzone or charcoal 5.0% Eudragit S100 2.0% Citric Acid 0.9% polyethylene glycol MW400 0.1% ______________________________________

Optionally, a stilbene brightener can be added to the formulation to enhance infectivity or potentiate the insecticidal effects of the insect virus.

The preferred composition described above is formulated as follows:

a) preparing an aqueous suspension of Eudragit S100 (1% w/v);

b) dissolving the Eudragit S100 by adding the pH of the suspension of step (a) to 9.0 to 9.5;

c) adding viral PIBs and UV-9 oxybenzone or charcoal to the solution of step (b), and blending to produce an even suspension;

d) air drying the even suspension of step (c);

e) milling the dried material of step (d) to produce milled material; and

f) dry blending the milled material of step (e) with Morwet D425, Morewet EFW wetting agent, Kaolin Clay as a bulking agent, Microcell E as a flow agent, citric acid and polyethylene glycol MW400 to provide flexibility to the milled material.

BRIEF DESCRIPTION OF THE DRAWINGS

FIG. 1 is a schematic representation of the AcMNPV genome showing the location of the egt and genes. The AcMNPV genome is presented in map units and as EcoRI and HindIII restriction maps.

FIG. 2A is a schematic representation of the structures of the egt gene region of AcMNPV with restriction sites; FIG. 2B shows the location of the egt gene.

FIG. 3A-3D represents partial restriction maps of the 327 ORF, lef-2, the 603 ORF, and the polyhedrin gene (polh) region of AcMNPV strains. FIG. 3A is the map for the AcMNPV L-1 wild type (thin line represents L-1 DNA). FIG. 3B is the map of AcMNPV V-8 (thick line represents V-8 DNA). The extra HindIII site in lef-2 is one distinguishing (physical) characteristic of V-8. V-8 is missing both the MluI site within the 603 ORF and the EcoRV site between the 603 ORF and polh. The V-8 603 ORF has a premature stop codon generated by an insertion and is predicted to produce an incomplete, non-functional polypeptide product (note "X" through the 603 ORF). FIG. 3C is the map of vEcoRIHybI recombinant virus containing the portion of the V-8 genome indicated by the thick bar. Although the transfer plasmid used to construct this hybrid contained V-8 sequence to the MluI site at 1.93 m.u., allelic replacement limited V-8 sequences to the portion of lef-2 indicated. FIG. 3D is the map of vEcoRIHybIFS recombinant virus containing the entire V-8 MluI (1.93 m.u.) to EsDI (3.27 m.u.) fragment. The NaeI site in what was the 603 ORF has been destroyed via a four base pair deletion (asterisk denotes missing NaeI site).

FIGS. 4A-4D presents the DNA sequence of AcMNPV L-1 (SEQ ID NO:1) from the 327 ORF MluI site (nucleotide 2469) to the polh EspI site (nucleotide 4186) aligned with the corresponding sequence from the AcMNPV V-8 variant (SEQ ID NO:3). The V-8 sequence has a multitude of point mutations and four insertions as compared to the L-1 sequence. Identities are indicated by a vertical line. Sequence differences and insertions are in bold type. Startpoints of lef-2, the 603 ORF and polh are marked with asterisks (*). The natural termination codons of the L-1 lef-2 and 603 ORF are marked with pound signs. Crossover in vEcoRIHybI occurred in the dashed region between the two dollar signs at nucleotides 3003 and 3027. The premature stop codon generated by the insertion in the V-8 603 ORF is indicated by three consecutive carets. Sequence numbering in parentheses corresponds to that in O'Reilly et al. (1992) Baculovirus Expression Vectors: A Laboratory Manual, W. H. Freeman & Co., NY.

FIG. 5 presents the predicted amino acid sequences of AcMNPV L-1 and the V-8 lef-2 gene products (SEQ ID NO:2 and SEQ ID NO: 4, respectively). Identities are designated by vertical lines. Differences are designated by bold type and a period between the differing amino acid residues. DNA sequence differences between the L-1 and the V-8 are responsible for six amino acid differences between the two lef-2 gene products. Amino acid differences occur at residues 14, 89, 101, 114, 153 and 190. The recombinant virus vEcoRIHybIFS is expected to contain all these lef-2 amino acid differences, but VEcoRIHybI is predicted to contain only the mutations at residues 153 and 190. The crossover event in vEcoRIHybI occurred in the DNA region that encodes the residues marked by a line of asterisks.

FIGS. 6A-6B presents the nucleotide sequence (SEQ ID NO:5) of AcMNPV DNA in the region of the egt gene. The codons for translation initiation (atg) and termination (taa) for the egt open reading frame are indicated over the sequence. The 1094 bp fragment deleted in the EGTDEL virus is underlined. The positions from which the oligonucleotide primers (EGTDEL1 and EGTDEL2) used for PCR amplification are shown.

FIG. 7 presents DNA sequences for AcMNPV E2 (SEQ ID NO: 6 . . . ), AcMNPV V-8 (SEQ ID NO:7 . . . ) and V1000 (SEQ ID NO:8 . . . ) virus strains beginning at the Esp31 site upstream of the polyhedrin gene and extending into the pOlyhedrin coding region. The sequences were from one strand using primer PV1 Reverse, and nucleotides indicated as N were not identified.

DETAILED DESCRIPTION OF THE DISCLOSED EMBODIMENTS

Because faster acting insect viruses are desirable as insect control agents, a study was undertaken to search for baculovirus strains with such improved killing properties. Toward this end, a minimally passaged (in insect larvae) AcMNPV virus stock was amplified, plated in culture to obtain clonal isolates, and these isolates were examined for restriction site polymorphisms and for increased virulence in insect larvae. A minimally passaged stock was used as the starting material for this survey, in part because serial passage in cell culture was known to lead to mutations and perhaps reductions in virulence in AcMNPV (see, e.g., Kumar and Miller (1987) Virus Research 7:335-349). Genotypic variants of AcMNPV were known (Lee and Miller (1978) J. Virol. 27:754-767). AcMNPV was the baculovirus for which a more virulent (i.e., faster killing) variant was sought because it is known to infect a relatively large number of insect pests of particular economic importance in agriculture.

The AcMNPV V-8 isolate was one of ten viral clones plaque purified on SF-21 cell monolayers inoculated with diluted hemolymph from Heliothis virescens larvae that had been orally infected with a minimal passage stock of the original Vail AcMNPV isolate (Vail et al., (1971) Proc. IV Int. Collog. Insect Pathology, College Park, Md. pp.297-304). All ten viral isolates, V-1 through V-10, were initially characterized by restriction endonuclease analysis with BamHI, BglII, EcoRI, HindIII, PstI, and XhoI and compared to AcMNPV L-1. The pattern of V-10 is identical to that of L-1. The profiles of V-1, V-2, V-3, V-6, V-7, V-8 and V-9 all lack the approximately 8.5 kb of HindIII-F fragment and instead contain two novel fragments of approximately 7.4 kb and 1.1 kb. Two isolates, V-4 and V-5, have a restriction pattern intermediate between the first two viral types (containing submolar quantities of the HindIII-F fragment and both the novel fragments of 7.4 kb and 1.1 kb). The presence of submolar fragments suggests that V-4 and V-5 are incompletely purified viral stocks, as all samples were plaque purified only once to preserve the virulence of the isolates. No differences in restriction profiles were detected between any of these ten clones and L-1 using BamHI, BglII, EcoRI, PstI, and XhoI digestion.

The V-8 isolate of AcMNPV was selected as representative of the predominant genotype of the ten isolates and was further characterized using Spodoptera frugiperda neonate bioassays. Data from representative bioassays evaluating oral infectivity (LC.sub.50) and virulence (LT.sub.50) are presented in Table 1. LC.sub.50 is the amount of virus at which 50% of infected larvae are dead within ten days after infection. LT.sub.50 is the time after infection when 50% of the infected larvae are dead when exposed to virus at LC.sub.90 unless otherwise indicated hereinbelow. In S. frugiperda and Trichoplusia ni neonates, the LC.sub.50 s of the L-1 and V-8 AcMNPV strains are very similar, but the LT.sub.50 s are significantly different in S. frugiperda neonates. For AcMNPV strains E-2 and L-1, death from infection normally occurs at about the same time after infection while V-8 causes death more quickly post infection than the L-1 and E2 strains. There is variability in the actual time until death from experiment to experiment, but the results are consistent from experiment to experiment for comparisons of the percent difference in time until death in the V-8 versus L-1 or E-2 comparisons. The average LT.sub.50 at LC.sub.90 of the V-8 isolate in S. frugiperda neonates is consistently about 12% shorter than the average LT.sub.50 of L-1.

Initial restriction analysis of AcMNPV V-8 versus AcMNPV L-1 with a battery of different restriction endonucleases (BamHI, BglII, EcoRI, HindIII, PstI, and XhoI) showed only the HindIII restriction polymorphism discussed above. The six restriction endonucleases used to characterize AcMNPV V-8 recognize a total of 95 sites in the AcMNPV genome, counting each EcoRI hr region (six short regions with highly repetitive DNA sequences and multiple EcoRI sites) as one site. Since each recognition site is a hexanucleotide, a total of 570 bp have been screened for mutations by restriction endonuclease analysis. The only difference found in this screen was a HindIII restriction polymorphism in lef-2 (a 0.18% mutation rate (1/570). The V-8 strain was subsequently shown to lack the EcoRV site which is located at about 90 bp upstream of the polyhedrin translation start site (see, e.g., FIG. 7).

Sequence analysis of 1.72 kb in the region surrounding the HindIII polymorphism revealed numerous nucleotide differences between L-1 and V-8 sequences in and around lef-2, the 603 ORF, and the polyhedrin gene (polh) (1.93 map units (m.u.) to 3.27 m.u.) (FIG. 2). There are 73 nucleotide changes in the 1.72 kb sequenced region. The HindIII restriction polymorphism in V-8 is due to a C to T mutation at nucleotide 3243. Both the MluI site (3389) in the 603 ORF and the EcoRV site (4001) between the polyhedrin gene and the 603 ORF were destroyed by single nucleotide changes (FIGS. 4 and 5). Several nucleotide substitutions in this region result in amino acid sequence changes in the predicted polypeptide products of lef-2, while insertions and substitutions substantially alter the 603 ORF. The six predicted amino acid changes in lef-2 are shown in FIG. 5. A 26 bp insert in the 603 ORF creates a stop codon within the open reading frame of the 603 ORF and is predicted to cause premature termination during 603 ORF translation. No sequence differences were discovered in the 327 ORF as far upstream as the MluI site. Only three DNA sequence differences between V-8 and L-1 were discovered in polh. These are third base pair changes which do not change the encoded amino acids. The region about 90 bp upstream of the polyhedrin translation start site of polh was generally unchanged, although the EcoRV site present in L-1 is absent in V-8.

Therefore, based on sequence and restriction analysis, this region of V-8 contains an unusually high density of mutations using L-1 as a wild-type comparison. Without wishing to be bound by any particular theory, it is postulated that AcMNPV V-8 arose by recombination between AcMNPV and a virus relatively distantly related to AcMNPV. Furthermore, considering the mutation density of V-8 in this region, the differences at nucleotides 2703 and 4194 of V-8 FIGS. 4A-4D and FIG. 7 may be the limits of the recombination, as no sequence differences were found as far downstream as the BamHI site beginning at nucleotide 4264 in L-1 polh as shown in FIG. 4 (i.e., nucleotide 331 of SEQ ID NO:7) and as far upstream as the 327 ORF MluI site (beginning at 1 in SEQ ID NO:3) at nucleotide 2469 (FIGS. 4A-4D and FIG. 7). Most of the mutations are concentrated in the 603 ORF and, to a lesser extent, in lef-2. Furthermore, complete V-8 vs. L-1 sequence analysis of the relatively distant 504 ORF (a phosphatase gene located between 0.0 m.u. and 0.4 m.u.) revealed no differences between L-1 and V-8.

The H. virescens colony at the American Cyanamid Agricultural Research Center, Princeton, N.J., was derived from a field isolate (Stoneville, Miss.) in 1966, and has been maintained since 1966. Air, water and diet are not thoroughly sterilized before coming in contact with H. virescens. It has been discovered that there are sporadic viral outbreaks in this colony. Virus, termed V-1000, has been isolated from this colony, partial genomic DNA sequence has been determined and various properties of the virus have been characterized. The V-1000 Nuclear Polyhedrosis Virus appears to be most closely related to Rachiplusia ou Nuclear Polyhedrosis Virus (RoNPV) based on restriction endonuclease analysis.

Based on a sequence comparison of V-8 and V-1000 polyhedrin regions, but without wishing to be bound by any particular theory, it is postulated that AcMNPV strain V-8 is a recombinant between AcMNPV and the V-1000 virus. A comparison of sequence between AcMNPV E-2 (ATCC VR-1344, American Type Culture Collection, 12301 Parklawn Drive, Rockville, Md.), V1000 and AcMNPV V-8 is presented in FIG. 7. The last sequence difference between the ACMNPV V-8 and E-2 strains occurs at the twentieth codon of the polyhedrin coding sequence.

Two recombinant viruses, vEcoRIhybI and vEcoRIHybIFS, were constructed by allelic replacement (see Example 3 and FIGS. 2A-2B) to determine if the reduced LT.sub.50 of AcMNPV V-8 was correlated with the sequence differences observed in the lef-2 region. Sequence analysis established which V-8 characteristic sequence differences these recombinants possessed following allelic recombination. Both recombinants had recombined downstream of the KpnI site in polh as evidenced by their occlusion positive phenotype. The parent virus vSynVIgal lacks polh sequences upstream of the KpnI site. The virus vEcoRIHybIFS contained the entire 1.72 kb MluI to EspI (1.93-3.27 m.u.) fragment with a four bp deletion at the NaeI site in what was the 603 ORF. The deletion in the V-8 603 ORF was intended to destroy the function of the product of the 603 ORF, but subsequent sequence analysis revealed that the V-8 603 ORF was already disrupted. Thus, this deletion is expected to have no additional effect on viral infectivity and virulence. Crossover during the allelic replacement event generating VEcoRIHybI occurred at some point between nucleotides 3003 and 3027 of AcMNPV sequence in FIGS. 4A-4D (between nucleotides 535 and 559 of SEQ ID NO:3), FIGS. 4A-4D and 6A-6B) and before the KDnI site within the polyhedrin gene. Thus, the Ief-2 gene product of VEcoRIHybI is predicted to be a hybrid containing L-1-like amino acid residues upstream of the crossover and V-8-like residues downstream of the crossover (FIGS. 4A-4D and 6A-6B).

Bioassays to determine infectivity and virulence of the viruses L-1, V-8, VEcoRIHybI, and VEcoRIHybIFs were performed on Spodoptera frugiperda neonates. Both LC.sub.50 s and LT.sub.50 s were computed using probit analysis (Daum (1970) Bulletin of the Entomological Society of America 16:10-15) for each virus (Table 1). The LC.sub.50 s of all four viruses were statistically equivalent. As previously noted, V-8 has a 12.4% shorter LT.sub.50 at LC.sub.90 than L-1, reflecting increased virulence. The differences between the LT.sub.50 s at LC.sub.90 of V-8, vEcoRIHybI and vEcoRIHybIFs are not statistically significant. However, the differences between the LT.sub.50 s at LC.sub.90 of L-1 and each of the three viruses containing V-8 DNA are statistically significant; V-8 and the two hybrid viruses each had a significantly shorter LT.sub.50 than L-1. Hybrid virus vEcoRIHybI contains only a small region of the V-8 sequences from the middle of lef-2 to the 5' end of polh but possesses the increased virulence characteristic of V-8. The fact that the lef-2 gene product of vEcoRIHybI has an L-1-like amino-terminus and a V-8 carboxy-terminus but still retains the V-8 virulence phenotype indicates that the increased virulence (decreased LT.sub.50) of V-8 is due either to one or both of the lef-2 carboxy-terminal amino acid differences or to the absence of a functional 603 ORF gene product, or some combination thereof. Alternatively, the V-8 faster killing (increased virulence) phenotype may be due to cis-acting sequence effects.

Whether the two carboxy-terminal lef-2 amino acid differences, the non-functional 603 ORF or a combination of these differences is responsible for the increased virulence of V-8 remains to be determined. Gearing and Possee (1990) J. Gen. Virol. 71:251-262 determined that the 603 ORF is not essential for production of budded virus in cell culture, production of polyhedra, or the infectivity (LC.sub.50) of AcMNPV. However, Gearing and Possee presented no data relevant to the virulence as measured by LT.sub.50 of their 603 ORF deletion mutant, so it is not known what effects the destruction of the 603 ORF had on the virulence of their mutant. Passarelli and Miller (1993) J. Virol. 67:2149-2158 reported that lef-2 and its 630 amino acid expression product is required for late and very late gene expression in transient expression assays. Without wishing to be bound by any particular theory, it is postulated that one or both of the V-8 lef-2 and 603 ORF alleles affect the rate of virus replication and therefore the virulence of the virus. It is possible that the faster killing by the V-8 strain is due to a cis or trans effect. The phenotype is believed to be carried within the region between nucleotides 3027 and 4231 in the V-8 sequence shown in FIGS. 4A-4D.

TABLE 1A ______________________________________ Bioassays of the infectivity of AcMNPV variants in S. frugiperda neonates. Fiducial Limits Virus LC.sub.50 Upper Lower Slope ______________________________________ L-1 4.6 .times. 10.sup.5 6.8 .times. 10.sup.5 3.0 .times. 10.sup.5 0.81 V-8 3.0 .times. 10.sup.5 4.3 .times. 10.sup.5 2.0 .times. 10.sup.5 0.97 vEcoRIHybI 5.5 .times. 10.sup.5 1.3 .times. 10.sup.6 1.9 .times. 10.sup.5 0.96 vEcoRIHybIFS 2.1 .times. 10.sup.5 2.9 .times. 10.sup.5 1.4 .times. 10.sup.5 1.06 ______________________________________

LC.sub.50 s (#PIBs/ml diet; polyhedrin inclusion bodies/ml) for L-1, V-8, vEcoRIHybI, and vEcoRIHybIFs were statistically equivalent.

TABLE 1B ______________________________________ Bioassays of the Virulence of AcMNPV Variants in S. frugiperda neonates Fiducial Limits Virus LT.sub.50 Upper Lower Slope ______________________________________ L-1 129.4 134.1 125.7 12.35 V-8 113.3 116.1 110.8 14.39 vEcoRIHybI 116.9 120.7 113.7 10.64 vEcoRIHybIFS 115.0 117.9 112.3 13.50 ______________________________________

(B) The LT.sub.50 s (in hours) at LC.sub.90 of V-8, vEcoRIHybI, and vEcoRIHybIFS were 10-12% faster than the LT.sub.50 of L-1 at LC.sub.90; this difference is statistically significant, as evidenced by the upper and lower fiducial limits.

The AaMNPV V-8 was genetically modified to inactivate the egt gene (egt encodes ecysteroid glycosyl transferase) following substantially the same procedure as described in U.S. Pat. No. 5,180,581. Then the LT.sub.50 values were determined using S. frugiperda neonates for AcMNPV L-1, the egt-deficient derivative of L-1 (vEGTDEL), AcMNPV V-8 and the V-8 derivative in which the egt gene was inactivated (V8vEGTDEL). The results are shown in Tables 2 and 3. Clearly, AcMNPV V-8 killed faster than L-1, and V8vEGTDEL killed even faster than the AcMNPV V-8.

TABLE 2 ______________________________________ S. frugiperda neonate bioassays V8vEGTDEL V8vEGTDEL Virus V8 isolate 1 L1 vEGTDEL isolate 2 ______________________________________ A. Dose: 2 .times. 10.sup.7 PIB/ml (100% mortality) Upper limit 90 75.7 106 86.8 77 LT50 84 70.6 103.6 81.5 72 Lower limit 84 66 101 76.5 68 B. Dose: 5 .times. 10.sup.6 PIB/ml (92% to 100% mortality) Upper limit 91.8 83 109 101 85.5 LT50 86.4 76.5 105 93 79 Lower limit 81 70.6 102 85.6 73 ______________________________________

TABLE 3 ______________________________________ Bioassays of LT.sub.50 s V8, L-1 and egt deletions in S. frugiperda neonates Virus Upper Limit LT50 Lower Limit % kill ______________________________________ A. V8vEGTDEL 81.6 75.4 69.8 96 V8 99.6 95 91 90 B. L-1 106 102 98 90 vEGTDEL 89.7 84.2 78.9 96 ______________________________________

In diet overlay bioassays using second instar H. virescens larvae, LT.sub.50 values for V8vEGTDEL were lower than for the corresponding V-8 virus, and V-8 had lower LT.sub.50 values than the L-1 strain. The vEGTDEL and V-8 had similar LT.sub.50 values, and V8vEGTDEL had lower LT.sub.50 than vEGTDEL (L-1). Using diet overlay tests with second instar Helicoverpa zea larvae, V8vEGTDEL exhibited significantly faster killing than AcMNPV E2. In insect larval tests, V8vEGTDEL appeared to kill infected insects faster than the AcMNPV L-1 egt-deletion strain (vEGTDEL). LC.sub.50 values calculated on PIBs/16 cm.sup.2 arena in diet overlay bioassays for AcMNPV wild-type strains (as E2 or L-1) were 1.times.10.sup.5 to 1.times.10.sup.6 for S. frugiperda and H. zea; 1.times.10.sup.3 to 1.times.10.sup.4 for S. eridania; and 1.times.10.sup.1 to 1.times.10.sup.2 for T. ni, S. exigua and H. virescens.

Thus, preferred viruses for insect control carry both a genetic region conferring the increased virulence phenotype and a genetic modification inactivating the gene encoding ecdysteroid glycosyl transferase. Preferred regions carrying the increased virulence phenotype are those from region of the lef-2 and ORF 603 region of the RoNPV genome. Functional equivalents of this regions from other baculoviruses can be readily identified, isolated and manipulated using the teachings of the present disclosure and technology well known to the art.

Lepidopteran insects undergo a well characterized sequence of events during development from egg to adult insect (see Comprehensive Insect Physiology, Biochemistry and Pharmacology, Vols. 7 and 8, Kerkut and Gilbert (eds.), Pergamon Press, Oxford, 1984 for detailed reviews). After hatching, the insect larva enters a period of extensive feeding during which time it will molt several times to allow continued growth. Stages between successive molts are known as instars. At the end of the larval growth period, the larva pupates and finally emerges as an adult insect. The processes of molting and pupation (collectively termed ecdysis) are regulated by the concerted actions of several different groups of hormones. The initial stimulus is the release of prothoracicotropic hormone (PTTH) by certain brain cells. This stimulates the prothoracic glands to produce and secrete ecdysteroids, often referred to as insect molting hormones. In the presence of juvenile hormone, a larval molt will ensue, while in the absence of juvenile hormone, the larvae will pupate. Eclosion hormone is also important in mediating several behavioral changes associated with ecdysis.

AcMNPV, which is used as a model system for much baculovirus research, interferes with the process of insect development. Insect larvae infected with AcMNPV are no longer able to molt or pupate because AcMNPV directs the synthesis of an enzyme, known as ecdysteroid UDP-glucosyl transferase (EGT), which specifically inactivates the insect ecdysteroids by conjugating them to galactose in vivo (O'Reilly et al. (1991) Insect Biochem. Molec. Biol. 22:313-320) or glucose in vitro (O'Reilly et al. Science 245:1110-1112). Other baculoviruses carry egt genes as well.

The AcMNPV gene encoding EGT extends from 8.4 to 9.6 map units on the AcMNPV genome (FIGS. 1 and 2A-2B. FIGS. 2A-2B shown the restriction map of the egt region of the genome. The nucleotide sequence of the AcMNPV (strain L1) egt gene and the deduced amino acid sequence of 506 amino acids are shown in SEQ ID NO:1 and 2, respectively. The coding sequence of egt extends from nucleotide 149 to about nucleotide 1670.

In a preferred embodiment of the present invention, the egt gene of the AcMNPV V-8 strain is inactivated by replacing a portion of the egt gene with a bacterial sequence encoding .beta.-galactosidase. This recombinant baculovirus is designated V8vEGTDEL herein. In a second preferred embodiment, part of the egt gene of the V8 strain AcMNPV is deleted without replacement, for example, by deleting an EcoRI/XbaI segment from within the egt coding sequence (See FIGS. 6A-6B; U.S. Pat. No. 5,180,581; Example 7 hereinbelow). An alternate mechanism for the inactivation of the insect virus egt gene is the insertion of a gene encoding an insect hormone affecting ecdysis, an enzyme which inactivates an insect hormone affecting ecdysis, which gene is expressible in an insect cell infected with said insect virus or an insect-specific toxin gene.

Using the AcMNPV egt gene as a probe, an egt gene has been identified in the baculovirus Orgyia pseudotsugata nuclear polyhedrosis virus (OpMNPV). It will be recognized by those skilled in the art with the benefit of this disclosure that the egt gene of any baculovirus can be characterized and isolated in a similar manner as AcMNPV (see, e.g., U.S. Pat. No. 5,180,581, incorporated by reference herein in its entirety). egt genes with at least 70% nucleotide sequence homology to the egt coding sequence in FIGS. 6a-6B from nucleotides 149 to 1666 (and in SEQ ID NO:1, from nucleotide 149 to 1666) are considered equivalent to said sequence, provided those homologous genes encode an enzyme which is an ecdysteroid UDP-glycosyl transferase, and their identification, isolation and manipulation will be readily achieved by the skilled worker using the sequences and assay information provided, taken together with what is well known in the art.

Functional equivalents of the egt gene are those which also catalyze the inactivation of ecdysteroids such as ecdysone by transferring a glucose or galactose moiety from UDP-glucose to the ecdysteroid(s). Those functional equivalents of egt may be identified using the assay methods described herein.

By inhiblting molting and pupation via the effects of ecdysteroid glycosyl transferase, wt AcMNPV infection can actually prolong larval feeding time. Baculoviruses which lack a functional egt gene do not prolong larval feeding time. Larvae infected with egt-deficient baculoviruses may pupate, and they succumb to the viral infection even more rapidly than larvae infected with the corresponding wt virus. The more rapid killing by a baculovirus lacking a functional egt gene is most dramatically seen when newly hatched first instar larvae are infected with wt AcMNPV and with vEGTZ. Larvae infected with vEGTZ succumb to the viral infection 3 to 4 days sooner than larvae infected with wt AcMNPV. Therefore, baculoviruses lacking a functional egt gene are considerably more effective as insect control agents than wild-type baculoviruses. It will be apparent to those skilled in the art with the benefit of this disclosure that the egt gene can be rendered nonfunctional in any baculovirus by any means known to the art.

Although the length of time progeny virus can accumulate in larvae infected with baculoviruses lacking a functional egt gene is somewhat truncated and the infected insect displays reduced growth, there is substantial production of progeny virus. The amount of virus obtained per larva following vEGTZ infection of late instar larvae is about 15 to 50% that obtained with wt virus. This is sufficient to allow cost-effective preparation of large quantities of virus particles.

In another embodiment of the present invention, an insect virus lacking a functional egt gene is modified by genetic engineering techniques so that its effectiveness as a biological control agent is further enhanced by incorporating a second gene whose product affects insect development.

The gene encoding PTTH (a peptide hormone) can be inserted into the Vital genome with the egt gene inactivated and PTTH can be expressed at levels sufficiently high to affect ecdysis. Insect larvae infected with such a virus experience extreme disruption in the hormonal control of development. These insects become sick rapidly resulting in severely compromised growth and development, reduced feeding, and earlier death. PTTH sequences are described in Kawakami et al. (1990) Science 247:1333).

It is important to note that, while all of the above genes could be added to wild-type virus genome using disclosure provided herein and/or in U.S. Pat. No. 5,180,581 and techniques well known to the art, they would not be expected to significantly affect insect behavior in the wild-type virus because expression of the egt gene by wild-type virus inactivates the ecdysteroid molting hormones and ecdysis is prevented, regardless of the production of other hormones. Thus, successful strategies involving the generation of viruses designed to interfere with insect ecdysis depend upon prior inactivation of the egt gene.

It will be understood by those skilled in the art that mutant organisms lacking an intact egt gene or incapable of expressing a functional egt product and those which are further genetically modified so as to express another hormone-modifying enzyme or a peptide developmental hormone are included as insect control agents of the present invention.

An isolated and purified insect virus is one which has been cloned through plaque purification in tissue culture, for example, or otherwise prepared from a single viral genotype. A recombinant insect virus, as used herein, is one which has at least one portion of its genotype derived from a heterologous insect virus, i.e., an insect virus of different taxonomic viral species. A recombinant insect virus may be generated by co-infection of one insect cell or insect with one than one viral species, or it may be the result of introducing insect virus genomic DNA and a heterologous insect DNA virus segment into the same insect or insect cell, with the result that a portion of the heterologous DNA becomes incorporated in the insect virus genome by recombination process. It is understood in the art that such a recombinant virus can be recognized via restriction endonuclease analysis, DNA sequencing at least a portion of the putative recombinant genome or via a change in phenotype. As specifically exemplified herein, recombinant insect viruses are recognized by their increased virulence phenotype (lower LT.sub.50) in at least one target insect as compared with the parental insect virus. A recombinant insect virus phenotype with the faster killing phenotype can be further genetically modified and further improved as an insect control agent by inactivating an ecdysteroid modifying enzyme, for example.

As used herein, an insecticidal composition has at least one active ingredient which has an adverse affect on insect pests, preferably which kills said pests. The present invention is the use of a recombinant insect virus which has been isolated or which has been genetically engineered to kill at least one insect pest faster than the corresponding wild-type comparison using a segment of heterologous insect virus DNA. A heterologous insect virus DNA segment is one which is not normally associated with the genome of the parent of the recombinant virus. As specifically exemplified herein, a portion of a baculovirus genome has been isolated and identified and shown to confer a phenotype of faster insect killing (as measured using the LT.sub.50 assay) when inserted into the AcMNPV L-1 genome, with Spodoptera frugiperda as the target insect. When an Egt-deficient derivative of that recombinant insect virus is used, feeding by insects is reduced in response to the insect egt-deficient recombinant virus, normal insect ecdysis is disrupted and death of the insect is further accelerated relative to the isogenic wild-type strain (i.e., with functional egt). A recombinant virus of this invention can also be an insect virus genetically engineered to inactivate a gene encoding an ecdysteroid modifying enzyme or one which is further engineered to express a heterologous gene encoding a protein which affects insect development, so as to minimize the time of insect feeding or to cause more rapid killing after virus infection.

It will be understood by those skilled in the art that the insect pests can be exposed to the viruses of the present invention by conventional methods including ingestion, inhalation or direct contact of the insect control agent.

A primary use of the recombinant and/or genetically engineered baculoviruses of the present invention will be as active ingredients of agricultural compositions for applying to plants to effect the biological control of insect pests of plants. Many variations of preparing such agriculturally suitable compositions for insect control are known in the art. The insecticidal compositions of this invention are typically administered at dosages in the range of 2.4.times.10.sup.8 to 2.4.times.10.sup.12 PIBs/hectare of recombinant insect virus.

Insecticidal compositions suitable for applications to plants to control insect pests comprise an agriculturally suitable carrier and an insect control agent, i.e., an insect virus, preferably a baculovirus. Conventional formulation technology known to persons skilled in the art is used to prepare the compositions of this invention. The compositions can be in the form of wettable powders, dispersible granular formulations, granules, suspensions, emulsions, solutions for aerosols, baits and other conventional insecticide preparations. Wetting agents, coating agents, agents to promote physical flexibility, UV protectants, dispersants and sticking agents are desirable additives in at least some formulations. The compositions will frequently include an inactive carrier, which can be a liquid such as water, alcohol, hydrocarbons or other organic solvents, or a mineral, animal or vegetable oil, or a powder such as talc, clay, silicate or kieselguhr. A nutrient such as sugar may be added to increase feeding behavior and/or to attract insects. Flow agents, for example, clay-based flow agents, may be added to minimize caking of the wettable powders or other dry preparations during storage. Application of an insecticidal composition of this invention can protect plants from insect pests by reducing feeding by and killing of susceptible insects.

The skilled artisan knows how to choose an insect virus which is suitable for the control of a particular insect pest. The concentration of the insect control agent that will be required to produce insecticidally effective agricultural compositions for plant protection will depend on the type of crop, target insect, virus genotype used and the formulation of the composition. Insecticidal compositions may be formulated, for example, as wettable powders, with about 10% (w/w) polyhedrin inclusion bodies. The insecticidally effective concentration of the insect control agent within the composition can readily be determined experimentally by a person of ordinary skill in the art.

Agricultural compositions must be suitable for agricultural use and dispersal in fields. Generally, components of the composition must be non-phytotoxic and not detrimental to the integrity of the occluded virus. Foliar applications must not damage or injure plant leaves. In addition to appropriate solid or, more preferably, liquid carriers, agricultural compositions may include sticking and adhesive agents, emulsifying and wetting agents, but no components which deter insect feeding or any viral functions. It is desirable to add components which protect the insect control agent from UV inactivation. Agricultural compositions for insect pest control may also include agents which stimulate insect feeding.

Reviews describing methods of application of biological insect control agents and agricultural application are available. See, for example, Couch and Ignoffo (1981) in Microbial Control of Pests and Plant Disease 1970-1980, Burges (ed.), chapter 34, pp. 621-634; Corke and Rishbeth, ibid, chapter 39, pp. 717-732; Brockwell (1980) in Methods for Evaluating Nitrogen Fixation, Bergersen (ed.) pp. 417-488; Burton (1982) in Biological Nitrogen Fixation Technology for Tropical Agriculture, Graham and Harris (eds.) pp. 105-114; and Roughley (1982) ibid, pp. 115-127; The Biology of Baculoviruses, Vol. II, supra.

Field trials AcMNPV E-2, V8vEGTDEL and a commercial Bacillus thuringiensis subsp. kurstaki insecticide (DIPEL 2.times., Abbott Laboratories, Chicago, Ill.) were carried out during the fall growing season in Arizona. Although the pest infestation was relatively light, results from this study indicated that V8vEGTDEL was efficacious against T. ni in young lettuce (Table 4). Following the fourth application of treatments (on ca. 5-day intervals), V8vEGTDEL at 1.times.10.sup.11 and 1.times.10.sup.12 PIBs/A provided better control of T. ni than similar doses of AcMNPV-E2 "wild-type". Additionally, V8vEGTDEL at 1.times.10.sup.11 and 1.times.10.sup.12 PIBs/A provided control of the T. ni infestation at levels equal to that provided by DIPEL 2.times.at 1 lb/A. Based on data collected after only three applications, however, DIPEL 2.times.provided better pest control than either baculovirus.

After completion of data collection, the test site (as well as 10-ft wide perimeter) was sprayed with an aqueous dilution of 1% (v/v) bleach. The treated crop, as well as a 10-ft wide perimeter, was then destroyed by using tractor-mounted tillage equipment. About 3 weeks later, soil samples were collected from several sites located within 100 ft of the test site. No V8vEGTDEL virus were detected in soil surrounding the test site, and no additional action was taken.

TABLE 4 ______________________________________ Efficacy of selected baculovirus treatments against Trichoiplusia ni in lettuce Mean # larvae/10 Mean # larvae/10 Treatment.sup.1 Dose/A.sup.2 plants at 3DA3T plants at 5DA4T ______________________________________ V8vEGTDEL 1 .times. 10.sup.10 PIBs 15 a b.sup.3 20 a 1 .times. 10.sup.11 PIBs 20 a 2 c 1 .times. 10.sup.12 PIBs 12 b 7 b c AcMNPV E2 1 .times. 10.sup.10 PIBs 10 b 18 a 1 .times. 10.sup.11 PIBs 18 a 20 a 1 .times. 10.sup.12 PIBs 12 b 10 b DIPEL 2X 1 lb form 0 c 7 b c Untreated -- 20 a 18 a ______________________________________ .sup.1 Baculovirus compositions were formulated as watersoluble wettable powders (1 .times. 10.sup.11 PIBs/10 gm). .sup.2 Baculovirus compositions were applied at 1 .times. 10 .sup.E 9, 1 .times. 10.sup.11, and 1 .times. 10.sup.13 PIBs/A on day 15, however, due to poor mixing and spray characteristics of the 1 .times. 10.sup.13 dose, both baculovirus were applied at 1 .times. 10.sup.10, 1 .times. 10.sup.11 and 1 .times. 10.sup.12 PIBs/A in all subsequent applications at days 5, 10 and 15. DIPEL 2X was also applied on days 1, 5, 10 and 15. .sup.3 Means within columns followed by the same letter are not significantly different (DMRT, P = 0.05).

In a second fall field trial, the efficacy of V8vEGTDEL, AcMNPV E2 and a commercial B. thuringiensis subsp. kurstaki insecticide (DIPEL 2.times., Abbott Laboratories, Chicago, Ill.) against the cabbage looper in New Jersey was tested. Vital insecticidal compositions were formulated as wettable powders.

Due to the light pest infestation in this study, differences among treatments in control of T. ni larvae were very slight (and generally not statistically significant). However all treatments had significantly fewer live larvae and less plant defoliation than untreated cabbage (Table 5). At 7 days after last application of treatments, untreated plots averaged 18% defoliation whereas cabbage treated with V8vEGTDEL or AcNPV-E2 "wild type" (rates of 1.times.10.sup.9, 1.times.10.sup.11, and 1.times.10.sup.12 PIBs/A) averaged 8-10% defoliation and DIPEL-treated (1 lb/A) cabbage averaged 4% defoliation. At 12 days after last application, untreated plots had a mean of 6.5 live larvae/10 plants whereas baculovirus -(1.times.10.sup.11 and 1.times.10.sup.12 PIBs/A) and DIPEL-treated plots averaged<2 larvae/10 plants.

After data collection was complete, the test site (as well as 10-ft wide perimeter) was sprayed with an aqueous dilution of 1% (v/v) bleach. The treated crop, as well as a 10-ft wide perimeter, was then destroyed by using tractor-mounted cultivation equipment. About five months after the bleach treatment, soil samples were again collected from several sites located within 100 ft of the test site. Also on this date, the test site was treated with AcMNPV-E2 "wild-type" at a rate of 1.times.10.sup.12 PIBs/A. No V8vEGTDEL was detected in these later soil samples.

TABLE 5 ______________________________________ Efficacy of selected baculovirus treatments against Trichoplusia ni in cabbage Mean # larvae/10 Mean # larvae/10 Treatment.sup.1 Dose/A.sup.2 plants at 3DA3T plants at 5DA4T ______________________________________ V8vEGTDEL 1 .times. 10.sup.9 PIBs 10 b.sup.3 2.0 b 1 .times. 10.sup.11 PIBs 11 b 1.2 b c 1 .times. 10.sup.12 PIBs 7 b c 1.7 b c AcMNPV E2 1 .times. 10.sup.9 PIBs 8 b c 2.0 b 1 .times. 10.sup.11 PIBs 8 b c 0.8 b c 1 .times. 10.sup.12 PIBs 11 b 0.8 b c DIPEL 2X 1 lb form. 4 c 0.2 c Untreated -- 8 a 6.5 a ______________________________________ .sup.1 Both types of baculoviruses were formulated as watersoluble wettable powders (1E11 PIBs/10 gm of WP). .sup.2 "EGTdeleted" and "Wildtype" (at 1 .times. 10.sup.9 and 1 .times. 10.sup.11 PIBS/A) and DIPEL 2X were applied three times. Due to severe clogging of nozzles, the planned baculovirus does of 1 .times. 10.sup.13 PIBs/A, so no baculovirus "high dose" was applied at the first applicatio and V8vEGTDEL and AcMNPV E2 at 1 .times. 10.sup.12 PIB/A were applied and were subsequently applied only twice (5 and 10 days later). .sup.3 Means within columns followed by the same letter are not significantly diffeent (DMRT, P = 0.05).

A third field trial for efficacy of V8vEGTDEL, AcMNPV E2 and a commercially available B. thuringiensis subsp. awaizai insecticide (Xentari, Abbott Laboratories, Chicago, Ill.) for control of T. ni in lettuce was carried out in spring in Florida.

The data are summarized in Table 5. V8vEGTDEL provided significantly faster control of T. ni than AcMNPV V8. Five days after treatment with V8vEGTDEL (1.times.10.sup.12 PIBs/A) caused 100% larval mortality whereas V8 at the same dose caused only 29% larval mortality (up to 97% mortality by day 7). Also, V8vEGTDEL (1.times.10.sup.11 PIBs/A) exhibited larval control at a rate equal to that of V8 at 1.times.10.sup.12 PIBs/A.

The commercial Bt product Xentari (1 lb form./A), provided 76% larval control by day 4 vs. only 40% larval control from V8vEGTDEL (1.times.10.sup.12 PIBs/A). However, by day 5, V8vEGTDEL (1.times.10.sup.12 PIBs/A) and Xentari (1 lb/A) exhibited 100% and 89% larval mortality, respectively.

TABLE 6 ______________________________________ Efficacy of field applications of V8vEGTDEL and AcMNPV V8 ("wild-type") against Trichoplusia ni in lettuce Dose Mean % larval mortality.sup.2 Treatment.sup.1 per acre Day 4 Day 5 Day 6 Day 7 ______________________________________ V8vEGTDEL 1 .times. 10.sup.11 PIBs 0 35 88 100 V8vEGTDEL 1 .times. 10.sup.12 PIBs 40 100 -- -- AcMNPV V-8 1 .times. 10.sup.12 PIBs 4 29 68 97 Xentari 1 lb 76 89 92 95 ______________________________________ .sup.1 Baculovirus compositions were formulated as wettable powder. .sup.2 Treatments were applied to six trueleaf lettuce (4 plots/treatment RCT design). About 3 hrs. after application, leaves were harvested from fieldplots, individually placed into petri dishes containing watermoistened filter paper, and then infested with threeday-old T. ni larvae (ca. 10 larvae/leaf). Two days later, larvae were placed in CDInternational trays containing untreated Stoneville artificial diet (1 larva/dietwell), and percent mortality was rated on each of several days posttreatment.

The examples provided herein use many techniques well known and accessible to those skilled in the arts of molecular biology, in the manipulation of recombinant DNA in plant tissue and in the culture and regeneration of transgenic plants. Enzymes are obtained from commercial sources and are used according to the vendors' recommendations or other variations known to the art. Reagents, buffers and culture conditions are also known to the art. References providing standard molecular biological procedures include Sambrook et al. (1989) Molecular Cloning, second edition, Cold Spring Harbor Laboratory, Plainview, N.Y.; R. Wu (ed.) (1993) Methods in Enzymology 218; Wu et al. (eds.) Methods in Enzymology 100, 101; Glover (ed.) (1985) DNA Cloning, Vols. I and II, IRL Press, Oxford, UK; and Hames and Higgins (eds.) (1985) Nucleic Acid Hybridization, IRL Press, Oxford, UK. Abbreviations and nomenclature, where employed, are deemed standard in the field and are commonly used in professional journal such as those cited herein. All references cited in the present application are expressly incorporated by reference herein.

This invention is illustrated by the following examples, which are not to be construed in any way as imposing limitations on the scope thereof. It is understood that resort may be had to various other embodiments, modifications, and equivalents thereof which, after reading the description herein, may suggest themselves to those skilled in the art without departing from the spirit of the present invention and/or the scope of the appended claims.

THE EXAMPLES

Example 1

Isolation of AcMNPV V-8

A minimally passaged AcMNPV stock from the original AcMNPV isolated by Pat Vail (Vail et al. (1971) Proc. IV Int. Colloq. Insect Pathology, College Park, Md. pp. 297-304) was amplified in Heliothis virescens larvae from the H. virescens colony at American Cyanamid, Princeton, N.J. The H. virescens are reared on a soybean-wheat germ agar-based diet at 28.degree. C. under constant fluorescent light. Virus was then further amplified in H. virescens larvae. Ten vital clones were plaque-purified from diluted hemolymph from the latter infected H. virescens larvae. Methods for plaque assay, plaque purification, virus amplification and viral DNA preparation are described in O'Reilly et al. (1992) Baculovirus Expression Vectors; A Laboratory Manual, W. H. Freeman & Co., New York, N.Y. Unless otherwise indicated, viruses were propagated in the IPLB-SF-21 cell line (SF-21) (Vaughn et al., 1977) In Vitro 13:213-217) using TC100 medium (Gibco BRL, Gaithersburg, Md.) supplemented with 0.26% tryptose broth and 10% fetal bovine serum (Intergen, Purchase, NY). SF-21 cells are commercially available (e.g., Invitrogen Corporation, San Diego, Calif.). DNA was prepared from each isolate and characterized by restriction endonuclease analysis in parallel with DNA prepared from the L-1 strain of AcMNPV, which is described in Lee and Miller (1978) J. Virol. 27:754.

Example 2

Analysis of the AcMNPV lef-2 and 603 ORF Region

Molecular biology techniques were used as previously described (Maniatis et al., 1989). Plasmid pRI-I contains the 7.33 kb AcMNPV L-1 EcoRI-I fragment cloned in the EcoRI site of pBR322. Plasmid pEcoRI-IV8 contains the V-8 EcoRI-I fragment in the EcoRI site of Bluescript KS+ (Stratagene, La Jolla, Calif.). Plasmid pEcoRIHybI was constructed by replacing the 1.72 kb MluI to EspI fragment (1.93-3.27 m.u.) in the L-1 EcoRI-I fragment with the corresponding fragment from V-8. The hybrid EcoRI-I fragment was then recloned into a pUC19 vector, producing pUC19HybI, a plasmid with a unique NaeI site in the 603 ORF. A plasmid with a frameshift mutation at this NaeI site, pUC19HybIFS, was produced by digesting pUC19HybI with NgoAIV (an isoschizomer of NaeI which produces cohesive ends), blunt-ending the overhanging ends with mung bean nuclease, and relegating the blunt ends to produce a four base pair deletion that destroys the NaeI site and disrupts the 603 ORF reading frame. This frameshift, Which was confirmed by dideoxynucleotide sequencing (United States Biochemical Corp. Sequenase kit, Cleveland, Ohio.), was predicted, on the basis of the published L-1 DNA sequence of AcMNPV [Possee et al., (1991) Virology 185:229-241], to cause premature termination of 603 ORF translation at a site fourteen amino acids downstream of the deletion.

Example 3

Virus Bioassays

Polyhedral inclusion bodies (PIBs) of L-1, V-8, vEcoRIHybI, and vEcoRIHybIFS were prepared simultaneously from infected Trichoplusia ni larvae as previously described (O'Reilly et al., 1992). LC.sub.50 data (the concentration of virus [PIBs/ml of diet] required for one half of the larvae to die by ten days post infection) and LT.sub.50 data (the time taken, at a specific viral concentration, for one half of the larvae to die) were collected from neonate bioassays performed on Spodoptera frugiperda larvae. Neonates were allowed to feed for 24 hours on diet containing various concentrations of PIBs from the viruses being assayed and then transferred to individual cups containing diet without virus. The seven doses of each virus assayed were 5.times.10.sup.4, 2.times.10.sup.5, 5.times.10.sup.5, 1.times.10.sup.6, 2.times.10.sup.6, 5.times.10.sup.6, and 2.times.10.sup.7 PIBs/ml. Sixty larvae were assayed per dose. Larval mortality was recorded at 48, 72, 84, 90, 96, 102, 108, 120, 132, and 144 hours post infection (p.i.). A final mortality count was performed at ten days post infection. LT.sub.50 and LC.sub.50 values were determined using probit analysis (Daum (1970) Bulletin of the Entomological Soc. of America 16:10-15).

Alternate virulence testing was done as follows: Trays were purchased from C-D International, Inc., and contained 32 separate arenas per tray. Each 4.times.4 cm (16 cm.sup.2) arena contained 5 ml of appropriate artificial diet. Clear vented adhesive tops from C-D International, Inc., enclosed the insect in the area following treatment and infestation. These clear tops allowed for easy scoring. The surface of the Stoneville (soybean/wheat germ diet) or pinto bean (Bio-Serv, Inc., Frenchtown, N.J. Diet #9393) diet was contaminated with 0.4 ml of aqueous viral solution. The dilutions ranged from 1.times.10.sup.8 to 1.times.10.sup.7 PIBs/ml, in 10-fold dilutions, depending upon the insect species tested. The applications were evenly distributed by rotating the tray and solutions were allowed to dry in a laminar flow hood. Bioassay trays were held at 28.degree. C. in continuous fluorescent light throughout the study period. Readings were taken twice a day to observe early onset time of infection. LC.sub.50 values were calculated from the BASIC log/probit statistics package and based on mortality versus dose at 8 days post-treatment. The T.sub.0 (time at 0 hours) was based on initial average time when the larva was exposed to the treated diet. The LT.sub.50 value was calculated from the BASIC log/probit statistics package based on mortality versus hours. The LT.sub.50 data calculated were derived from the LD.sub.95 value (based on a dose that was preferably less than 2 logs greater than the LC.sub.50 value).

Example 4

Recombinant Virus Construction

Recombinant viruses are prepared essentially as described in O'Reilly et al. (1992) supra. The recombinant viruses vEcoRIHybI and vEcoRIHybIFS were constructed by cotransfecting SF-21 cells with vSynVI gal DNA (Wang et al. (1991) Gene 100:131-137) and either pUC19HybI plasmid DNA (for vEcoRIHybI) or pUC19HybIFS plasmid DNA (for vEcoRIHybIFs) (See Example 2). The virus vSynVI gal expresses the E. coli lacZ gene instead of the polyhedrin gene and forms occlusion negative (OCC), blue plaques in the presence of the chromogenic .beta.-galactosidase indicator X-gal. Both pUC19HybI and pUC19HybIFS contain a polyhedrin gene; thus recombination between plasmid DNA derived from the polyhedrin region and vital DNA produced white occlusion positive (OCC.sup.+) viral plaques. Viruses forming white OCC.sup.+ plaques have lost the lacZ gene and acquired a functional polyhedrin gene through allelic replacement.

Example 5

Field Testing of Variant Baculovirus

The field trial program evaluates the efficacy of V8vEGTDEL relative to AcMNPV wild-type against important lepidopteran pests which attack vegetables. Pest organisms targeted in these field trials include cabbage looper, Trichoplusia ni; beet armyworm, Spodoptera exigua; fall armyworm, Spodoptera frugiperda; southern armyworm, Spodoptera eridania; tobacco budworm, Heliothis virescens; corn earworm, Helicoverpa zea; diamondback moth, Plutella xylostella; cabbageworm, Pieris rapae. Each test is conducted on land currently used for growth/production of row crops (i.e., commercial or research farms). The crop used in each test is a leafy vegetable (e.g., lettuce) or a crucifer (e.g., cabbage). Each field trial consists of the following eight treatments: V8vEGTDEL (see Examples 6 and 7 hereinbelow) at 1.times.10.sup.9, 10.sup.11, and 10.sup.13 PIBs/acre; AcMNPV at 1.times.10.sup.9, 10.sup.11, and 10.sup.13 PIBs/acre, and untreated control. Within a given test, each treatment will be applied to the crop no more than six (6) times; treatments will be applied on an "as needed" basis (i.e., as pest populations warrant, probably 5- to 14-day intervals).

Within each test, there is a maximum of six applications of each treatment. Treatments are applied to plots in each test by using ground equipment, either small tractor sprayers or CO.sub.2 -driven backpack sprayers. Treatments are diluted in water and applied through standard agricultural hydraulic spray booms and nozzles. The maximum size of a treatment plot (i.e., replicate) in each test is 0.018 acres (i.e., 4 rows wide.times.60 ft. long, row spacing of 40 in.). The maximum number of plots (i.e., replicates) per treatment in each test is four. Each test is monitored on at least a weekly basis for the duration of the study. Each of these trials will be conducted on secured private farm land or research farms (no trespassing by unauthorized individuals). At the conclusion of each test, the test area and a 10 ft.-wide untreated test perimeter undergo "crop destruction" (i.e., rather than being harvested for commercial use, the treated and adjacent crop is shredded and plowed underground).

Soil is perhaps the most important reservoir for persistence of virus in the environment. The monitoring program consists of the collection of 4 soil samples (each 7.6 cm in depth) totaling 500 g from within the test site and from an area 100 ft outside the treatment zone. Samples are taken approximately midway through the test. A second set of samples are collected at the end of the test after all disinfection procedures (as described below) have been completed.

Monitoring for viable, infectious virus is important because immunodetection and PCR methods make no distinction between infectious occlusion bodies and non-viable remnants of viral particles. The only reliable method for determining if viable, infectious viral particles are present in the soil samples is to perform bioassays of the samples on a highly susceptible insect host such as Heliothis virescens. From each 500 g sample of soil, 25 g is used in the bioassay. A standard method for isolation of vital occlusion bodies from soil is used. This method efficiently recovers approximately 46% of polyhedra from soil. The LC.sub.50 for AcMNPV in our standard diet overlay assay is 300-1000 polyhedra/arena for H. virescens. Therefore, if each larvae to be bioassayed is fed the isolate from 1 g of soil, this assay reliably detects 600-2000 viral occlusion bodies per gram of assayed soil. Larvae which exhibit typical symptoms of viral infection in the bioassay are examined for the presence of occlusion bodies using light microscopy. If polyhedra are observed, they are isolated from the cadaver for DNA isolation from the occlusion bodies and a standard PCR assay (routinely performed in the lab) is done using primers flanking the vEGTDEL deletion (See FIGS. 6A-6B , e.g.). The efficiency of DNA recovery and the PCR assay approaches 100%. If the virus present is vEGTDEL, then a DNA fragment of a characteristic size is observed, allowing unambiguous identification of the virus as vEGTDEL. Other viruses generate DNA fragments of differing sizes.

AcMNPV variants having deletions in the egt gene can arise spontaneously in nature, and such viruses ares subject to a severe replicative disadvantage that will not allow them to compete effectively with indigenous viruses in the environment. Furthermore, since egt-inactivated virus produce 30%-50% fewer polyhedra following a successful infection, environmental persistence is further compromised. Contaminated plants within the test site and 10 ft.-wide buffer, tools, and farm implements are topically sterilized with a 1% bleach wash to prevent unnecessary dispersal of the vital insecticide.

The V8vEGTDEL formulation for the field trial program is in the form of a wettable powder. On a weight:weight basis, ingredients of this formulation are as follows:

______________________________________ % Weight ______________________________________ V8vEGTDEL 10.00 Eudragit S100 0.45 UV-9 oxybenzone 2.50 polyethylene glycol MW400 0.10 MiraSperse 39.10 REAX ATN lignin sulfonate 4.90 10X Sugar 19.45 Morewet EFW 19.60 Microcel E 3.90 100.00 ______________________________________

Eudragit S100 (Rohm Pharma Co.) comprises methyl methacrylic and methyl methacrylate. It is a pH dependent coating agent which holds UV9 on the PIBs, and it slightly prolongs photostability of the formulation. UV-9 oxybenzone (Cytech Ind.) also provides slight photostability to the formulation. Polyethylene glycol MW400 (Aldrich Chemical Co.) provides flexibility to the UV-protectant coatings. MiraSperse (Staley Co.) is a starch-based "sticker", and provides rainfastness to the formulation after it is applied to the crop. REAX ATN (West Waco Co.) is a lignin sulfonate, and it is used as a dispersant and keeps the particles separate in the liquid phase (i.e., in the water diluent). Sugar is used as an insect feeding stimulant and/or attractant. Morewet EFW (Witco Co.) is a wetting agent, so that the formulation can more effectively spread across the surface of a treated leaf. Microcel E (Manville Co.) is a clay-based flow agent that prevents the wettable powder from caking during storage.

For use in the test formulations, the PIBs (polyhedrin inclusion bodies) are air-milled to under 10 .mu.m in size, and coated with an organic solution containing Eudragit S100, UV-9, and MW400. The other aforementioned inerts are blended and Fitz-milled to make a pre-blend. The coated PIBs and the pre-blend are blended together and Fitz-milled, and then the formulation is packaged. No extraneous microorganisms will be present in the formulation since production in tissue culture requires the use of sterile procedures. In each 10 g of wettable powder formulation, there is 1 g (2.times.10.sup.11 PIBs) of V8vEGTDEL.

A preferred wettable powder insecticidal composition is as follows:

______________________________________ Ingredient Nominal Percent (w/w) ______________________________________ V8vEGTDEL polyhedrin 10.0% inclusion bodies Morwet D425 30.0% Morewet EFW 20.0% Kaolin Clay 16.0% Microcel E 16.0% UV-9 oxybenzone or charcoal 5.0% Eudragit S100 2.0% Citric Acid 0.9% polyethylene glycol MW400 0.1% ______________________________________

The active ingredient is V8vEGTDEL. Morewet D425 is used as a dispersant and keeps the particles separate in the liquid phase (i.e., in the water diluent). Morewet EFW (Witco Co.) is a wetting agent, so that the formulation can more effectively spread across the surface of a treated leaf. Kaolin Clay is a bulking agent. Microcel E (Manville Co.) is a flow agent that prevents the wettable powder from caking. UV-9 (or charcoal) provides slight photostability to the formulation. Eudragit S100 (Rohm Pharma Co.) also slightly prolongs photostability of the formulation. Citric acid is used for pH adjustment. MW400 (Aldrich Chemical Co.) provides flexibility to the UV-protectant coatings.

A stilbene brightener is optionally added (at approximately 5% w/w) to PIBs in alternative preferred wettable powder formulations, and the percentages of other inert ingredients are then adjusted accordingly. Stilbenes provide some protection against UV inactivation and can also serve to enhance or potentiate virus infectivity, particularly in insects which are less susceptible to the insect virus, see, e.g., U.S. Pat. No. 5,246,936 (issued Sep. 21, 1993, Treacy et al.), which is incorporated by reference herein.

In this formulation the PIBs are first coated using an aqueous coating procedure. A 1% (w/v) suspension of Eudragit S100 is prepared in water. The Eudragit is dissolved by adjusting the pH to between 9.0 and 9.5. Viral PIBs, Blankophor BBH (stilbene brightner, Miles Inc; if used), and UV-9 oxybenzone or charcoal in the proper proportions are added. The mixture is blended to create an even suspension and then air-dried. The dried coated PIBs are then air-milled to achieve a small particle size. This material is then dry blended with the prescribed amounts of Morwet 425, Morewet EFW, Kaolin Clay, Microcell E, Citric acid and polyethylene glycol MW400 and then packaged as the final formulation. The preferred particle size of the blended material is less than 20 .mu.m.

Example 6

The position of the egt gene on the AcMNPV genome is illustrated in FIG. 2B. A scale in map units is presented above the map of the AcMNPV genome in FIG. 1A. The nucleotide sequence of the AcMNPV L-1 egt gene and flanking regions has been determined (FIG. 6, SEQ ID NO:5). FIG. 1A shows a linear map of the AcMNPV L-1 genome after cleavage with restriction endonucleases EcoRI and HindIII. FIG. 1B is an enlargement of the AcMNPV genome from 7.6 to 11.1 map units showing the location of the egt gene. The AcMNPV strain L-1 has been described (Lee and Miller (1978) J. Virol. 27:754). Cloned L-1 DNA fragments and the names of the resultant plasmids are shown in FIG. 1C. Fragment 1, which extends from the PstI site at 7.6 mu to a BamHI site at 11.1 mu, is cloned into the plasmid. vector pUC19; fragments 2 and 3 (from PstI (7.6 mu) to EcoRI (8.65 mu) and from EcoRI (8.65 mu) to SalI (10.5 mu), respectively) are both cloned into the vectors Bluescript M13+ and Bluescript M13- (Stratagene, San Diego, Calif.). Fragment 5 (BstEII (8.35 mu) to BstEII (8.7 mu) is cloned into Bluescript M13+.

The nucleotide sequence of the egt gene is presented in FIG. 6 and in SEQ ID NO:5 from nucleotide 149 to 1669.

Example 7

To construct AcMNPV recombinant viruses (e.g., V-8) incapable of expressing a functional egt gene, further manipulation of the plasmid clones described in Example I is required. Plasmid pUCBCPsB is cleaved with restriction endonucleases EcoRI and XbaI (see FIG. 3 for sites within the egt gene) and the small fragment is discarded. The Escherichia coli lacZ gene, excised from pSKS104 (Casadaban et al. (1983) Methods Enzymol. 100:293-303) with EcoRI and AhaIII, is then inserted between the EcoRI and XbaI sites after the XbaI overhanging ends are filled in using T4 DNA polymerase. The resultant plasmid is designated pEGTZ. In this plasmid, the inserted lacZ gene is in frame with the preceding egt coding sequences. Alternatively, the plasmid pEGTDEL is constructed by simply ligating the EcoRI and XbaI sites together (after both sites have been blunt-ended) without inserting any sequences between them.

Plasmid pEGTZ is then cotransfected with AcMNPV V-8 DNA into SF cells as described in Miller et al. (1986) supra. This procedure allows for homologous recombination to take place between sequences in the viral and plasmid DNAs, resulting in replacement of the viral egt gene with the egt-lacZ gene fusion from the plasmid. Because the remaining egt coding sequence is in frame with the lacZ sequences, such a recombinant virus will produce a fusion protein comprising the first 84 amino acids of egt joined to .beta.-galactosidase. The recombinant virus, termed vEGTZ, can be identified because .beta.-galactosidase expression gives rise to blue viral plaques in the presence of a chromogenic indicator such as 5-bromo-4-chloro-3-indolyl-.beta.-D-galactopyranoside (X-gal).

Recombinant virus V8vEGTDEL is obtained by cotransfecting the plasmid pEGTDEL and DNA from the virus vEGTZ into SF cells. Homologous recombination results in the replacement of the egt-lacZ fusion gene in V8vEGTZ with the deleted egt gene from pEGTDEL. The recombinant virus vEGTDEL is identified by its failure to form blue plaques in the presence of X-gal.

In a specific embodiment of an AcMNPV V-8 virus in which the egt is inactivated, a DNA fragment from 7.6-11.1 map units on the physical map of AcMNPV was cloned into a plasmid vector as described in U.S. Pat. No. 5,180,581, incorporated by reference herein.

This AcMNPV fragment contains the egt gene and flanking viral DNA. An internal deletion was made in the egt gene and the E. coli lacZ gene was fused in frame. The initial egt-deleted virus, designated vEGTZ, was constructed using this fusion plasmid to replace the egt gene in AcMNPV by allelic recombination mediated by cellular recombination mechanisms. Presence of a functional lacZ gene facilitated the identification of the recombinant virus by its blue color in plaque assays in the presence of an appropriate chromogenic indicator. An additional egt-deleted virus, vEGTDEL, was constructed by deleting an internal portion of the egt gene from the plasmid vector containing the 7.6-11.1 map unit region of the AcMNPV genome using PCR mediated mutagenesis. The sequence of the egt coding region and flanking sequences are shown in FIG. 6, along with the locations of the PCR primers. Deletion at the precise sites indicated in FIG. 3 results in the formation of two novel and easily characterized restriction enzyme sites (EcoRI and XhaI) at the deletion junction. This. deletion plasmid was then used to replace the egt-deleted lacZ gene.

Example 8

Egt enzymatic activity protein can be determined as follows: SF cells are infected with AcMNPV as described hereinbefore. Twelve hours post infection the cells and extracellular media are collected and processed separately. Uninfected cells are treated in parallel. Cell lysates or extracellular media are incubated in the presence of 1 mM UDP-glucose, UDP-galactose and 0.25 .mu.Ci[.sup.3 H] ecdysone as described in O'Reilly and Miller (1989) Science 245:1110-1112. Ecdysteriod UDP-glucosyl transferase activity in the cell lysates or media catalyze the transfer of glucose from the UDP-glucose to ecdysone to form an ecdysone-glucose conjugate. Ecdysone and the ecdysone-sugar conjugate are separated from one another by silica gel thin layer chromatography (Bansal and Gessner (1988) Anal. Biochem. 10.9:321) and visualized by autoradiography. Ecdysone-glucose conjugates (G) are only formed when wt AcMNPV-infected cell lysate or extracellular medium is assayed. No conjugates are observed when uninfected or egt-inactivated virus-infected cell lysates or media are used, showing that the activity is due to egt expression. Most of the activity is located in the extracellular medium.

It should be understood that the foregoing relates only to preferred specific embodiments of the present invention and that numerous modifications or alterations may be made therein without departing from the spirit and the scope of the invention as set forth in the appended claims.

__________________________________________________________________________ SEQUENCE LISTING (1) GENERAL INFORMATION: (iii) NUMBER OF SEQUENCES: 8 (2) INFORMATION FOR SEQ ID NO:1: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 1721 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: NO (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION: 194..826 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:1: ACGCGTTCCGGCACGAGCTTTGATTGTAATAAGTTTTTACGAAGCGATGACATGACCCCC60 GTAGTGACAACGATCACGCCCAAAAGAACTGCCGACTACAAAATTACCGAGTATGTCGGT120 GACGTTAAAACTATTAAGCCATCCAATCGACCGTTAGTCGAATCAGGACCGCTGGTGCGA180 GAAGCCGCGAAGTATGGCGAATGCATCGTATAACGTGTGGAGTCCGCTC229 MetAlaAsnAlaSerTyrAsnValTrpSerProLeu 1510 ATTAGAGCGTCATGTTTAGACAAGAAAGCTACATATTTAATTGATCCC277 IleArgAlaSerCysLeuAspLysLysAlaThrTyrLeuIleAspPro 152025 GATGATTTTATTGATAAATTGACCCTAACTCCATACACGGTATTCTAC325 AspAspPheIleAspLysLeuThrLeuThrProTyrThrValPheTyr 303540 AATGGCGGGGTTTTGGTCAAAATTTCCGGACTGCGATTGTACATGCTG373 AsnGlyGlyValLeuValLysIleSerGlyLeuArgLeuTyrMetLeu 45505560 TTAACGGCTCCGCCCACTATTAATGAAATTAAAAATTCCAATTTTAAA421 LeuThrAlaProProThrIleAsnGluIleLysAsnSerAsnPheLys 657075 AAACGCAGCAAGAGAAACATTTGTATGAAAGAATGCGTAGAAGGAAAG469 LysArgSerLysArgAsnIleCysMetLysGluCysValGluGlyLys 808590 AAAAATGTCGTCGACATGCTGAACAACAAGATTAATATGCCTCCGTGT517 LysAsnValValAspMetLeuAsnAsnLysIleAsnMetProProCys 95100105 ATAAAAAAAATATTGAACGATTTGAAAGAAAACAATGTACCGCGCGGC565 IleLysLysIleLeuAsnAspLeuLysGluAsnAsnValProArgGly 110115120 GGTATGTACAGGAAGAGGTTTATACTAAACTGTTACATTGCAAACGTG613 GlyMetTyrArgLysArgPheIleLeuAsnCysTyrIleAlaAsnVal 125130135140 GTTTCGTGTGCCAAGTGTGAAAACCGATGTTTAATCAAGGCTCTGACG661 ValSerCysAlaLysCysGluAsnArgCysLeuIleLysAlaLeuThr 145150155 CATTTCTACAACCACGACTCCAAGTGTGTGGGTGAAGTCATGCATCTT709 HisPheTyrAsnHisAspSerLysCysValGlyGluValMetHisLeu 160165170 TTAATCAAATCCCAAGATGTGTATAAACCACCAAACTGCCAAAAAATG757 LeuIleLysSerGlnAspValTyrLysProProAsnCysGlnLysMet 175180185 AAAACTGTCGACAAGCTCTGTCCGTTTGCTGGCAACTGCAAGGGTCTC805 LysThrValAspLysLeuCysProPheAlaGlyAsnCysLysGlyLeu 190195200 AATCCTATTTGTAATTATTGAATAATAAAACAATTATAAATGCTAAAT853 AsnProIleCysAsnTyr 205210 TTGTTTTTTATTAACGATACAAACCAAACGCAACAAGAACATTTGTAGTATTATCTATAA913 TTGAAAACGCGTAGTTATAATCGCTGAGGTAATATTTAAAATCATTTTCAAATGATTCAC973 AGTTAATTTGCGACAATATAATTTTATTTTCACATAAACTAGACGCCTTGTCGTCTTCTT1033 CTTCGTATTCCTTCTCTTTTTCATTTTTCTCCTCATAAAAATTAACATAGTTATTATCGT1093 ATCCATATATGTATCTATCGTATAGAGTAAATTTTTTGTTGTCATAAATATATATGTCTT1153 TTTTAATGGGGTGTATAGTACCGCTGCGCATAGTTTTTCTGTAATTTACAACAGTGCTAT1213 TTTCTGGTAGTTCTTCGGAGTGTGTTGCTTTAATTATTAAATTTATATAATCAATGAATT1273 TGGGATCGTCGGTTTTGTACAATATGTTGCCGGCATAGTACGCAGCTTCTTCTAGTTCAA1333 TTACACCATTTTTTAGCAGCACCGGATTAACATAACTTTCCAAAATGTTGTACGAACCGT1393 TAAACAAAAACAGTTCACCTCCCTTTTCTATACTATTGTCTGCGAGCAGTTGTTTGTTGT1453 TAAAAATAACAGCCATTGTAATGAGACGCACAAACTAATATCACAAACTGGAAATGTCTA1513 TCAATATATAGTTGCTGATATCATGGAGATAATTAAAATGATAACCATCTCGCAAATAAA1573 TAAGTATTTTACTGTTTTCGTAACAGTTTTGTAATAAAAAAACCTATAAATATGCCGGAT1633 TATTCATACCGTCCCACCATCGGGCGTACCTACGTGTACGACAACAAGTACTACAAAAAT1693 TTAGGTGCCGTTATCAAGAACGCTAAGC1721 (2) INFORMATION FOR SEQ ID NO:2: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 210 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:2: MetAlaAsnAlaSerTyrAsnValTrpSerProLeuIleArgAlaSer 151015 CysLeuAspLysLysAlaThrTyrLeuIleAspProAspAspPheIle 202530 AspLysLeuThrLeuThrProTyrThrValPheTyrAsnGlyGlyVal 354045 LeuValLysIleSerGlyLeuArgLeuTyrMetLeuLeuThrAlaPro 505560 ProThrIleAsnGluIleLysAsnSerAsnPheLysLysArgSerLys 65707580 ArgAsnIleCysMetLysGluCysValGluGlyLysLysAsnValVal 859095 AspMetLeuAsnAsnLysIleAsnMetProProCysIleLysLysIle 100105110 LeuAsnAspLeuLysGluAsnAsnValProArgGlyGlyMetTyrArg 115120125 LysArgPheIleLeuAsnCysTyrIleAlaAsnValValSerCysAla 130135140 LysCysGluAsnArgCysLeuIleLysAlaLeuThrHisPheTyrAsn 145150155160 HisAspSerLysCysValGlyGluValMetHisLeuLeuIleLysSer 165170175 GlnAspValTyrLysProProAsnCysGlnLysMetLysThrValAsp 180185190 LysLeuCysProPheAlaGlyAsnCysLysGlyLeuAsnProIleCys 195200205 AsnTyr 210 (2) INFORMATION FOR SEQ ID NO:3: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 1763 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: NO (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION: 194..826 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:3: ACGCGTTCCGGCACGAGCTTTGATTGTAATAAGTTTTTACGAAGCGATGACATGACCCCC60 GTAGTGACAACGATCACGCCCAAAAGAACTGCCGACTACAAAATTACCGAGTATGTCGGT120 GACGTTAAAACTATTAAGCCATCCAATCGACCGTTAGTCGAATCAGGACCGCTGGTGCGA180 GAAGCCGCGAAGTATGGCGAATGCATCGTATAACGTGTGGAGTCCGCTC229 MetAlaAsnAlaSerTyrAsnValTrpSerProLeu 1510 ATTAGCGCGTCATGTTTAGACAAGAAAGCTACATATTTAATTGATCCC277 IleSerAlaSerCysLeuAspLysLysAlaThrTyrLeuIleAspPro 152025 GATGATTTTATTGATAAATTGACCCTAACTCCATACACGGTATTCTAC325 AspAspPheIleAspLysLeuThrLeuThrProTyrThrValPheTyr 303540 AATGGCGGGGTTTTGGTCAAAATTTCCGGACTGCGATTGTACATGCTG373 AsnGlyGlyValLeuValLysIleSerGlyLeuArgLeuTyrMetLeu 45505560 TTAACGGCTCCGCCCACTATTAATGAAATTAAAAATTCCAATTTTAAA421 LeuThrAlaProProThrIleAsnGluIleLysAsnSerAsnPheLys 657075 AAACGCAGCAAGAGAAACATTTGTATGAAAGAATGCGCAGAAGGAAAG469 LysArgSerLysArgAsnIleCysMetLysGluCysAlaGluGlyLys 808590 AAAAATGTCGTTGACATGCTGAACAGCAAGATCAATATGCCTCCGTGT517 LysAsnValValAspMetLeuAsnSerLysIleAsnMetProProCys 95100105 ATAAAAAAAATATTGGGCGATTTGAAAGAAAACAATGTACCACGCGGC565 IleLysLysIleLeuGlyAspLeuLysGluAsnAsnValProArgGly 110115120 GGTATGTACAGGAAGAGATTTATATTAAACTGTTACATTGCAAACGTG613 GlyMetTyrArgLysArgPheIleLeuAsnCysTyrIleAlaAsnVal 125130135140 GTTTCGTGTGCCAAATGTGAAAACCGATGTTTAATCAATGCTCTGACG661 ValSerCysAlaLysCysGluAsnArgCysLeuIleAsnAlaLeuThr 145150155 CATTTCTACAACCACGATTCCAAATGTGTGGGTGAAGTCATGCATCTT709 HisPheTyrAsnHisAspSerLysCysValGlyGluValMetHisLeu 160165170 TTAATTAAATCCCAAGATGTTTATAAACCACCAAACTGCCAAAAAATG757 LeuIleLysSerGlnAspValTyrLysProProAsnCysGlnLysMet 175180185 AAAAATGTCGACAAGCTTTGCCCGTTTGCTGGCAACTGCAAGGGTCTC805 LysAsnValAspLysLeuCysProPheAlaGlyAsnCysLysGlyLeu 190195200 AATCCTATTTGTAATTATTGAATAATAAAACAATTATAAATGCTAAAT853 AsnProIleCysAsnTyr 205210 TTGTTTTTTATTAACGATACAAACCAAACGCAACAAGAACATTTGTAGAATTATCTATAA913 TTGAAAACGCATAATTATAATCGTCAAGGTAATGTTTAAAATCATTTTCAAATGATTCAC973 AGTTAATTTGCGACAGTATAATTTTGTTTTCACATAAACTAGACGCCTTTATCTGTCTGT1033 CGTCTTCTTCGTATTCTTTTTCTTTTTCATTTTTCTCTTCATAAAAATTCACATAATTAT1093 TATCGTATCCATATATGTATCTGTCGTAAAGAGTAAATTTTTTGTTGTCATAAATATATA1153 TGTCTTTTTTAATGGGGTGTATAGTACCGCTGCGCATAGTTTTTCTTTAATTTAAACCAG1213 TGCTATTTTCTGGTAATTCTTCGGAGTGTGTTGCTTTAATTATTAAATTTATATAATCAA1273 TGAATTTGGGATCGTCGGTTTTGTACAATATGTTGCCGGCATAGTACGCAGCTGGCTCTA1333 AATCAATATTTTTTAAACAACGACTGGATCAACATTACCATTTTTTAGCAACACTGGATT1393 AACATAATTTTCCAAAATGCTGTACGAAGCGTTTAACAAAAACAGTTCACCTCCGTTTTC1453 TATACTATCGTCTGCGAGCAGTTGCTTGTTGTTAAAAATAACGGCCATTGTAATGAAACG1513 CACAAACTAATATTACACACTAAAAAAATCTATCATTTCGGCTTAATATATAGTTGCTGA1573 TATTATGTAAATAATTAAAATGATAACCATCTCGCAAATAAATAAGTATTTTACTGTTTT1633 CGTAACAGTTTTGTAATAAAAAAACCTATAAATATGCCGGATTATTCATACCGTCCCACC1693 ATCGGGCGTACCTACGTGTACGACAACAAATATTACAAAAATTTAGGTGCCGTTATCAAG1753 AACGCTAAGC1763 (2) INFORMATION FOR SEQ ID NO:4: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 210 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:4: MetAlaAsnAlaSerTyrAsnValTrpSerProLeuIleSerAlaSer 151015 CysLeuAspLysLysAlaThrTyrLeuIleAspProAspAspPheIle 202530 AspLysLeuThrLeuThrProTyrThrValPheTyrAsnGlyGlyVal 354045 LeuValLysIleSerGlyLeuArgLeuTyrMetLeuLeuThrAlaPro 505560 ProThrIleAsnGluIleLysAsnSerAsnPheLysLysArgSerLys 65707580 ArgAsnIleCysMetLysGluCysAlaGluGlyLysLysAsnValVal 859095 AspMetLeuAsnSerLysIleAsnMetProProCysIleLysLysIle 100105110 LeuGlyAspLeuLysGluAsnAsnValProArgGlyGlyMetTyrArg 115120125 LysArgPheIleLeuAsnCysTyrIleAlaAsnValValSerCysAla 130135140 LysCysGluAsnArgCysLeuIleAsnAlaLeuThrHisPheTyrAsn 145150155160 HisAspSerLysCysValGlyGluValMetHisLeuLeuIleLysSer 165170175 GlnAspValTyrLysProProAsnCysGlnLysMetLysAsnValAsp 180185190 LysLeuCysProPheAlaGlyAsnCysLysGlyLeuAsnProIleCys 195200205 AsnTyr 210 (2) INFORMATION FOR SEQ ID NO:5: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 2793 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO (xi) SEQUENCE DESCRIPTION: SEQ ID NO:5: GTCGACGCGCTTCTGCGTATAATTGCACACTAACATGTTGCCCTTTGAACTTGACCTCGA60 TTGTGTTAATTTTTGGCTATAAAAAGGTCACCCTTTAAAATTTGTTACATAATCAAATTA120 CCAGTACAGTTATTCGGTTTGAAGCAAAATGACTATTCTCTGCTGGCTTGCACTGCTGTC180 TACGCTTACTGCTGTAAATGCGGCCAATATATTGGCCGTGTTTCCTACGCCAGCTTACAG240 CCACCATATAGTGTACAAAGTGTATATTGAAGCCCTTGCCGAAAAATGTCACAACGTTAC300 GGTCGTCAAGCCCAAACTGTTTGCGTATTCAACTAAAACTTATTGCGGTAATATCACGGA360 AATTAATGCCGACATGTCTGTTGAGCAATACAAAAAACTAGTGGCGAATTCGGCAATGTT420 TAGAAAGCGCGGAGTGGTGTCCGATACAGACACGGTAACCGCCGCTAACTACCTAGGCTT480 GATTGAAATGTTCAAAGACCAGTTTGACAATATCAACGTGCGCAATCTCATTGCCAACAA540 CCAGACGTTTGATTTAGTCGTCGTGGAAGCGTTTGCCGATTATGCGTTGGTGTTTGGTCA600 CTTGTACGATCCGGCGCCCGTAATTCAAATCGCGCCTGGCTACGGTTTGGCGGAAAACTT660 TGACACGGTCGGCGCCGTGGCGCGGCACCCCGTCCACCATCCTAACATTTGGCGCAGCAA720 TTTCGACGACACGGAGGCAAACGTGATGACGGAAATGCGTTTGTATAAAGAATTTAAAAT780 TTTGGCCAACATGTCCAACGCGTTGCTCAAACAACAGTTTGGACCCAACACACCGACAAT840 TGAAAAACTACGCAACAAGGTGCAATTGCTTTTGCTAAACCTGCATCCCATATTTGACAA900 CAACCGACCCGTGCCGCCCAGCGTGCAGTATCTTGGCGGAGGAATCCATCTTGTAAAGAG960 CGCGCCGTTGACCAAATTAAGTCCGGTCATCAACGCGCAAATGAACAAGTCAAAAAGCGG1020 AACGATTTACGTAAGTTTTGGGTCGAGCATTGACACCAAATCGTTTGCAAACGAGTTTCT1080 TTACATGTTAATCAATACGTTCAAAACGTTGGATAATTACACCATATTATGGAAAATTGA1140 CGACGAAGTAGTAAAAAACATAACGTTGCCCGCCAACGTAATCACGCAAAATTGGTTTAA1200 TCAACGCGCCGTGCTGCGTCATAAAAAAATGGCGGCGTTTATTACGCAAGGCGGACTACA1260

ATCGAGCGACGAGGCCTTGGAAGCCGGGATACCCATGGTGTGTCTGCCCATGATGGGCGA1320 CCAGTTTTACCATGCGCACAAATTACAGCAACTCGGCGTAGCCCGCGCCTTGGACACTGT1380 TACCGTTTCCAGCGATCAACTACTAGTGGCGATAAACGACGTGTTGTTTAACGCGCCTAC1440 CTACAAAAAACACATGGCCGAGTTATATGCGCTCATCAATCATGATAAAGCAACGTTTCC1500 GCCTCTAGATAAAGCCATCAAATTCACAGAACGCGTAATTCGATATAGACATGACATCAG1560 TCGTCAATTGTATTCATTAAAAACAACAGCTGCCAATGTACCGTATTCAAATTACTACAT1620 GTATAAATCTGTGTTTTCTATTGTAATGAATCACTTAACACACTTTTAATTACGTCAATA1680 AATGTTATTCACCATTATTTACCTGGTTTTTTTGAGAGGGGCTTTGTGCGACTGCGCACT1740 TCCAGCCTTTATAAACGCTCACCAACCAAAGCAGGTCATTATTGTGCCAGGACGTTCAAA1800 GGCGAAACATCGAAATGGAGTCTGTTCAAACGCGCTTATGTGCCAGTAGCAATCAATTTG1860 CTCCGTTCAAAAAGCGCCAGCTTGCCGTGCCGGTCGGTTCTGTGAACAGTTTGACACACA1920 CCATCACCTCCACCACCGTCACCAGCGTGATTCCAAAAAATTATCAAGAAAAACGTCAGA1980 AAATATGCCACATAATATCTTCGTTGCGTAACACGCACTTGAATTTCAATAAGATACAGT2040 CTGTACATAAAAAGAAACTGCGGCATTTGCAAAATTTGCTAAGAAAAAAGAACGAAATTA2100 TTGCCGAGTTGGTTAGAAAACTTGAAAGTGCACAGAAGAAGACAACGCACAGAAATATTA2160 GTAAACCAGCTCATTGGAAATACTTTGGAGTAGTCAGATGTGACAACACAATTCGCACAA2220 TTATTGGCAACGAAAAGTTTGTAAGGAGACGTTTGGCCGAGCTGTGCACATTGTACAACG2280 CCGAGTACGTGTTTTGCCAAGCACGCGCCGATGGAGACAAAGATCGACAGGCACTAGCGA2340 GTCTGCTGACGGCGGCGTTTGGTTCGCGAGTCATAGTTTATGAAAATAGTCGCCGGTTCG2400 AGTTTATAAATCCGGACGAGATTGCTAGTGGTAAACGTTTAATAATTAAACATTTGCAAG2460 ATGAATCTCAAAGTGATATTAACGCCTATTAATTTGAAAGGTGAGGAAGAGCCCAATTGC2520 GTTGAGCGCATTACCATAATGCCATGTATTTTAATAGATACTGAGATCTGTTTAAATGTC2580 AGATGCCGTTCTCCTTTTGCCAAATTCAAAGTATTGATTATTGTAGATGGCTTTGATAGC2640 GCTTATATTCAGGCTACCTTTTGTAGCATTAGCGATAGTGTAACAATTGTTAACAAATCT2700 AACGAAAAGCATGTAACGTTTGACGGGTTTGTAAGGCCGGACGATGAAGGTACAACAATG2760 CCTTATGTCATTGGACCATTATATTCTGTCGAC2793 (2) INFORMATION FOR SEQ ID NO:6: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 341 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO (xi) SEQUENCE DESCRIPTION: SEQ ID NO:6: TGAGACGCACAAACTAATATCACAAACTGGAAATGTCTATCAATATATAGTTGCTGATAT60 CATGGAGATAATTAAAATGATAACCATCTCGCAAATAAATAAGTATTTTACTGTTTTCGT120 AACAGTTTTGTAATAAAAAAACCTATAAATATGCCGGATTATTCATACCGTCCCACCATC180 GGGCGTACCTACGTGTACGACAACAAGTACTACAAAAATTTAGGTGCCGTTATCAAGAAC240 GCTAAGCGCAAGAAGCACTTCGCCGAACATGAGATCGAAGAGGCTACCCTCGACCCCCTA300 GACAACTACCTAGTGGCTGAGGATCCTTTCCTGGGACCCGG341 (2) INFORMATION FOR SEQ ID NO:7: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 351 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO (xi) SEQUENCE DESCRIPTION: SEQ ID NO:7: TGAAACGCACAAACTAATATTACACACTAAAAATGTCTATCATTTCGGCTTAATATATAG60 TTGCTGATATTATGTAAATAATTAAAATGATAACCATCTCGCAAATAAATAAGTATTTTA120 CTGTTTTCGTAACAGTTTTGTAATAAAAAAACCTATAAATATGCCGGATTATTCATACCG180 TCCCACCATCGGGCGTACCTACGTGTACGACAACAAATATTACAAAAATTTAGGTGCCGT240 TATCAAGAACGCTAAGCGCAAGAAGCACTTCGCCGAACATGAGATCGAAGAGGCTACCCT300 CGACCCCCTAGACAACTACCTAGTGGCTGAGGATCCTTTCCTGGGACCCGG351 (2) INFORMATION FOR SEQ ID NO:8: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 351 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO (xi) SEQUENCE DESCRIPTION: SEQ ID NO:8: TGAAACGCACAAACTAATATTACACACTAAAAAAATCTATCATTTCGGCTTAATATATAG60 TTGCTGATATTATGTAAATAATTAAAATGATAACCATCTCGCAAATAAATAAGTATTTTA120 CTGTTTTCGTAACAGTTTTGTAATAAAAAAACCTATAAATATGCCGGATTATTCATACCG180 TCCGACCATCGGGCGTACCTACGTGTACGACAACAAATATTACAAAAACTTGGGTTCTGT240 TATTAAAAACGCCAAGCGCAAGAAGCACCTAATCGAACATGAAGAAGAGGAGAAGNACTT300 GGATCCCTTAGACAATTACATGGTTGCCNNAGATCCTTTTCTAGGACCTGG351 __________________________________________________________________________

* * * * *

---