The present invention is directed to the isolation and purification of an L1-like molecule (i.e. L1CAM) from human brain. It has been found that the isolated L1CAM molecule supports neurite growth in vitro. Applicants have also cloned and sequenced the entire coding region of human L1CAM, and found that it shows a very high degree of homology to mouse L1cam with 92% identity at the amino acid level. This similarity suggest that L1CAM is an important molecule in normal human nervous system development and nerve regeneration. Overall, there is substantially less homology to chick Ng-CAM; they are 40% identical at the amino acid level but many regions are highly conserved. Comparison of the sequences from human, mouse, chick and Drosophila, indicates that the L1 immunoglobulin domain 2 and fibronectin type III domain 2 are strongly conserved and thus are likely functionally important.

Current U.S. Class:	536/23.5 ; 435/69.1; 536/23.1
Current International Class:	C07K 14/435 (20060101); C07K 14/705 (20060101); C07K 14/72 (20060101); G01N 33/74 (20060101); C12N 015/12 (); C12N 015/11 (); C12N 015/10 (); C12N 005/10 ()
Field of Search:	536/23.1,23.5 435/69.1,172.3

Fay, Sharpe, Beall, Fagan, Minnich & McKee

---

Parent Case Text

---

This is a continuation of application Ser. No. 07/953,493 filed on Sep. 28, 1992, now abandoned; which is a continuation-in-part of application Ser. No. 904,991 filed on Jun. 26, 1992, now abandoned.

---

Claims

---

Having thus described the preferred embodiments, the invention is now claimed to be:

1. An isolated DNA molecule for a human L1 cell adhesion molecule comprising the nucleotide sequence (SEQ ID NO: 2) identified in FIGS. 3A and 3B.

2. A CDNA which codes for part of the human L1CAM molecule, identified as cDNA clone c2 (SEQ ID NO: 6).

3. A cDNA which codes for part of the human L1CAM molecule, identified as cDNA clone 3.1 (SEQ ID NO: 3).

4. A cDNA which codes for part of the human L1CAM molecule, identified as cDNA clone 4 (SEQ ID NO: 4).

5. A cDNA which codes for part of the human L1CAM molecule, identified as cDNA clone 17 (SEQ ID NO: 5).

---

Description

---

FIELD OF THE INVENTION

The present invention is directed to the isolation and characterization of the entire coding sequence of human L1 cell adhesion molecule (L1CAM). In this regard, Applicants have cloned and sequenced four cDNAs, i.e. cDNA clone 3.1 (SEQ ID NO: 3), cDNA clone 4 (SEQ ID NO: 4), cDNA clone 17 (SEQ ID NO: 5), and cDNA clone C2 (SEQ ID NO: 6), encompassing the entire coding region of L1CAM (SEQ ID NO: 2). Collectively, the four cDNAs have a combined sequence (i.e. SEQ ID NO: 1) of 4529 bases in length.

The invention also relates to the nucleotide sequence (SEQ ID NO: 2) characterized by the present invention and the use of this sequence and the four cDNAs (SEQ ID NOS: 3-6) for studying the role of human L1 cell adhesion molecule (L1CAM) in normal and damaged neuronal tissue. In addition, the invention is directed to the isolated and purified polypeptide chain encoded by the nucleotide sequence of the invention.

BACKGROUND OF THE INVENTION

Cell adhesion molecules (abbreviated CAMs) are neuronal cell surface glycoproteins which help to mediate the cohesive interactions between developing or regenerating neurities. It is believed that proper adhesion of neuronal cells to each other and to their surrounding extracellular matrix is essential for maintaining and/or promoting growth of the neuronal cells.

A number of cell adhesion molecules have been isolated and identified, including neural cell adhesion molecule (N-CAM), nerve growth factor-inducible large external glycoprotein (NILE), neuron-glial CAM (Ng-CAM) and closely related proteins L1 (L1antigen). These integral membrane glycoproteins, or molecules closely related thereto, have been described by Applicants and others in the nervous system of several species.

Representative examples of such identification and description include L1cam in mouse, (Rathjen, F. G., Schachner, M., Immunocytological And Biochemical Characterization Of A New Neuronal Cell Surface Component (L1Antigen) Which Is Involved In Cell Adhesion. EMBO J. 3: 1-10 (1984)); NILE in rat, (McGuire, J. C., Greene, L. A., Furano, A. V., Nerve Growth Factor Stimulates Incorporation Of Fucose Or Glucosamine Into An External Glycoprotein In Cultures Rat PC12 Pheochromocytoma Cells. Cell 15: 357-365 (1978)); Ng-CAM/8D9/G4 in chick, (Grumet, M., Edelman, G. M., Neuron-Glia Cell Adhesion Molecule Interacts with Neurons and Astroglia via Different Binding Mechanisms. J. Cell Biol. 106: 487-503 (1988); and, Lemmon, V., McLoon, S., The Appearance Of An L1-Like Molecule In The Chick Primary Visual Pathway, J. Neurosci. 6: 2987-2994, (1986)); and Neuroglian in Drosophila (Bieber, A. J., Snow, P. M., Hortsch, M., Patel, N. H., Jacobs, J. R., Traquina, Z. R., Schilling, J., Goodman, C. S., Drosophila Neuroglian: A Member Of The Immunoglobulin Superfamily With Extensive Homology To The Vertebrate Neural Adhesion Molecule L1. Cell 59: 447-460 (1989)).

These molecules share similar biochemical properties, immunological crossreactivity, localization predominantly on axons of projection neurons, homology in nucleotide sequence as well as functional similarity.

The L1 cell adhesion molecule, which was first isolated and characterized in mouse (i.e. L1 cam) is a membrane-spanning glycoprotein that has sequence similarity with both fibronectin and the immunoglobulin superfamily. Specifically, L1 cell adhesion molecules possessing six extracellular Ig-like domains, three to five fibronectin (Fn) type III-like repeats, a transmembrane segment, and a small cytoplasmic region. The membrane-spanning region links the extensive extracellular domain to the substantial cytoplasmic domain.

Several lines of evidence suggest that the L1 cell adhesion molecule plays an important role in neuronal growth and fasciculation. First, it is expressed by subpopulations of neurons in the central nervous system and on nerons and Schwann cells in the peripheral nervous system. This expression is early on in developing (Martini, R., Schachner, M., Immunoelectron Microscopic Localization Of Neural Cell Adhesion Molecules (L1 , N-CAM, MAG) And Their Shared Carbohydrate Epitope And Myelin Basic Protein (MBP) In Developing Sciatic Nerve. J. Cell Biol. 103: 2439-2448 (1986)) and regenerating axons (Daniloff, J. K., Chuong, C. -M., Levi, G., Edelman, G. M., Differential Distribution Of Cell Adhesion Molecules During Histogenesis Of The Chick Nervous System. J. Neurosci. 6: 739-758 (1986); and, Martini, R., Schachner, M., Immunoelectron Microscopic Localization of Neural Cell Adhesion Molecules (L1, N-CAM, MAG) and Their Shared Carbohydrate Epitope and Myelin Basic Protein (MBP) in Developing Sciatic Nerve. J. Cell Biol. 103: 2439-2448 (1986)).

Secondly, since antibodies to L1 disrupt fascicle formation in vitro (Stallcup, W. B., Beasley, L., Involvement Of The Nerve Growth Factor-Inducible Large External Glycoprotein (NILE) In Neurite Fasciculation In Primary Cultures Of Rat Brain. Proc. Natl. Acad. Sci. USA 82: 1276-1280 (1985)) and in vivo (Landmesser, L., Dahm, L., Schultz, K., Rutishauser, U., Distinct Roles For Adhesion Molecules During Innervation Of Embryonic Chick Muscle. Dev. Biol. 130: 645-670 (1988)), L1 participates in axonal fasciculate formation.

Finally, it has been shown by Applicants and others that purified L1 is a potent substrate for neurite growth and development (Lagenaur, C., Lemmon, V., A L1-Like Molecule, The 8D9 Antigen, Is A Potent Substrate For Neurite Extension. Proc. Natl. Acad. Sci. USA 84: 7753-7757 (1987)).

Moreover, a number of observations are consistent with the existence of a L1 human homologue. Human tumors, especially neuroblastoma, demonstrate immunoreactivity to L1 antibodies (Mujoo, K., Spiro, R. C., Reisfeld, R. A., Characterization Of A Unique Glycoprotein Antigen Expressed On The Surface Of Human Neuroblastoma Cells. J Biol. Chem. 261: 10299-10305 (1986); and, Figarella-Branger, D. F., Durbec, P. L., Rougon, G. N., Differential Spectrum Of Expression Of Neural Cell Adhesion Molecule Isoforms And L1 Adhesion Molecules On Human Neuroectodermal Tumors. Cancer Research 50: 6364-6370 (1990)). In addition, Biochemical analysis of a glycoprotein isolated from human brain using an anti-neuroblastoma monoclonal antibody revealed that the antigen was very similar to mouse L1cam (Wolff, J. M., Frank, R., Mujoo, K., Spiro, R. C., Reisfeld, R. A., Rathjen, F. G., A human Brain Glycoprotein Related To The Mouse Cell Adhesion Molecule L1. J. Biol Chem. 263: 11943-11947 (1988)). To conform with the HGMW approved nomenclature, (Human Gene Mapping Workshop, published 1987 in Cytogenet. Cell Genet., Vol. 46, pages 11-28) mouse L1 cell adhesion molecule is referred hereinafter as "L1cam" and human L1 cell adhesion molecule is referred to as "L1CAM".

Recently, partial sequences obtained for a human genomic clone (Djabali, M., Mattei, M. G., Nguyen, C., Roux, D., Demengeot, J., Denizot, F., Moos, M., Schachner, M., Goridis, C., Jordan, B. R., The Gene Encoding L1, A Neural Adhesion Molecule Of The Immunoglobulin Family, Is Located On The X-Chromosome In Mouse And Man, Genomics 7: 587-593 (1990)) and a human melanoma cDNA clone (Harper, J. R., Prince, J. T., Healy, P. A., Stuart, J. K., Nauman, S. J., Stallcup, W. B., Isolation And Sequence Of Partial cDNA Clones of Human-L1- Homology Of Human And Rodent-L1 In The Cytoplasmic Region, J. Neurochem. 56: 797-804 (1991)) confirmed that a human L1-like molecule exists.

Further studies localized the gene for human L1 to the q28 band on the X chromosome (Djabali, M., Mattei, M. G., Nguyen, C., Roux, D., Demengeot, J., Denizot, F., Moos, M., Schachner, M., Goridis, C., Jordan, B. R., The Gene Encoding L1, A Neural Adhesion Molecule Of The Immunoglobulin Family, Is Located on the X-Chromosome in Mouse and Man, Genomics 7: 587-593 (1990)), the homologous region to the A6-B region of the mouse X chromosome where the L1 cam gene is located.

The knowledge that a L1-like molecule exists in humans leads to the conclusion that L1CAM may be important in promoting axon regeneration in trauma or disease states of the human nervous system. Therefore, the Applicants have isolated and purified L1 from human brain and conducted in vitro experiments on the natural substance that demonstrate that human L1CAM, like chick and mouse L1 cam, can support neuron attachment and neurite growth.

In addition, Applicants have cloned and sequenced cDNAs (SEQ ID NOS: 3-6) encompassing the entire coding region of L1CAM (SEQ ID NO: 2). This information will allow future studies on the structure and function of L1CAM and permit the construction of cell lines expressing L1CAM for in vitro and in vivo experiments on nerve growth and regeneration.

These and other objects and features of the invention will be apparent from the following description and from the claims.

SUMMARY OF THE INVENTION

In one aspect, the present invention is directed to the isolation and purification of an L1-like molecule (i.e. L1CAM) from human brain. It has been found that the isolated L1CAM molecule supports neurite growth in vitro. Applicants have also cloned (SEQ ID NOS: 3-6) and sequenced the entire coding region of human L1CAM (SEQ ID NO: 2), and found that it shows a very high degree of homology to mouse L1 cam with 92% identity at the amino acid level. This similarity suggest that L1 CAM is an important molecule in normal human nervous system development and nerve regeneration. Overall, there is substantially less homology to chick Ng-CAM; they are 40% identical at the amino acid level but many regions are highly conserved. Comparison of the sequences from human, mouse, chick and Drosophila, indicates that the L1 immunoglobulin domain 2 and fibronectin type III domain 2 are strongly conserved and thus are likely functionally important.

In another aspect, present invention provides for a method for isolating and completely characterizing the coding sequence of human L1CAM (SEQ ID NO: 2). Moreover, the invention provides various methods for using the identified nucleotide sequence (or DNA fragments thereof (SEQ ID NOS: 3-6)) for evaluating the function of human L1CAM in normal and damaged tissue.

In an additional aspect, the invention relates to procedures for determining and/or correcting genetic or acquired disorders of the central nervous system axonal tract.

Furthermore, the invention provides for use of the sequence (SEQ ID NO: 2) information characterized to synthesize the L1CAM glycoprotein itself or fragments thereof. Along this line, the invention relates to use of the identified nucleotide sequence (or DNA parts thereof (SEQ ID NOS: 3-6)) to synthesize L1CAM or modifications of this glycoprotein into microorganisms or other hosts which use the gene to synthesize the glycoprotein.

In a further aspect, the present invention provides for use of the cDNAs (SEQ ID NOS: 3-6) for comparison of recombinant L1CAM with product purified from human brain. This permits functional studies on the recombinant molecule to be conducted. Similarly, use of the characterized cDNAs, permits the construction of cell lines expressing normal and altered L1CAM for use in transplantation and regeneration studies.

In still another aspect, the invention provides for recombinant DNA cloning vectors and transformed hosts which contain a vector which has a cDNA insert (SEQ ID NOS: 3-6) which codes for L1CAM .

BRIEF DESCRIPTION OF THE DRAWINGS

The following is a brief description of the drawings which are presented for the purpose of illustrating the invention and not for the purpose of limiting same.

FIG. 1 is a photograph of a silver stained SDS-PAGE gel of immunopurified L1CAM. The molecular weight standards are indicated at the left.

FIG. 2 is a microphotograph of E7 chick retinal explants grown on L1CAM coated dishes. Control dishes coated with BSA had no neurite outgrowth. Scale, bar=100 microns.

FIGS. 3A and 3B shows the nucleotide (bottom line) and deduced amino acid (top line) sequence of the coding portion of L1CAM (SEQ ID NO: 2). Untranslated nucleotides are not shown. The boxed nucleotides represent areas of discrepancy as compared with other published L1CAM sequence data. Underlined regions represent the oligonucleotides used for screening the library. The asterisk represents a stop codon. The nucleotide sequence for L1CAM is available through GenBank Data L1 braries under Accession No. M64296.

FIGS. 4A and 4B shows a comparison at an amino acid level of L1CAM domains with corresponding domains in L1 cam and chick Ng-CAM. Gaps were introduced to maximize identities between the sequences. Identical residues are represented by a hash mark. The amino acids shown as being the transmembrane region include the link between the Fn-5 domain and the presumed membrane spanning region that begins with GWFI. The amino acids shown in FIG. 4 correspond to the amino acid sequences, SEQ ID. NOS. 9-44, set forth in the Sequence Listing.

FIG. 5 is a map of the four cloned cDNAs (i.e. 3.1 (SEQ ID NO: 3), 4 (SEQ ID NO: 4), 17 (SEQ ID NO: 5) and C2 (SEQ ID NO: 6)) that code for parts of L1CAM. A scale demonstrating the size differences in base pairs is shown beside the cloned cDNAs.

DETAILED DESCRIPTION OF THE INVENTION

L1CAM Purification

L1CAM was isolated and purified by immunoaffinity chromatography using similar purification methods previously described by the Applicants (Lemmon, V., Farr, K., Lagenaur, L1 Mediated Axon Outgrowth Occurs Via A Homophilic Binding Mechanism. Neuron 2: 1597-1603 (1989)). Briefly, neural membranes from 12 day full term neonatal human brain (the infant succumbed from complications of Trisomy 18) were isolated on sucrose gradients and then extracted with 1% deoxycholate. The extract was then run over a 74-5H7 IgG monoclonal antibody to L1 cam affinity column (Lemmon, V., Farr, K., Lagenaur, C., L1 Mediated Axon Outgrowth Occurs Via A Homophilic Binding Mechanism. Neuron 2: 1597-1603 (1989)). Antigens were eluted with 0.1 M diethylamine (pH 11.5) and the solution rapidly neutralized with Tris-HCl. Fractions were then dialyzed against PBS overnight. Gel electrophoresis of the purified product was performed on a 5% SDS-polyacrylamide gel.

A silver stained SDS-polyacrylamide gel of purified L1CAM is shown in FIG. 1. Notable is the characteristic doublet of bands at 190-180 kDa, a major band at 130 kDa, and minor bands at 105 kDa, 80 kDa, and 62 kDa. This is similar to the pattern reported by others for L1CAM (Mujoo, K., Spiro, R. C., Reisfeld, R. A., Characterization Of A Unique Glycoprotein Antigen Expressed On The Surface Of Human Neuroblastoma Cells. J Biol. Chem. 261: 10299-10305 (1986); and, Wolff, J. M., Frank, R., Mujoo, K., Spiro, R. C., Reisfeld, R. A., Rathjen, F. G., A Human Brain Glycoprotein Related To The Mouse Cell Adhesion Molecule L1. J Biol Chem. 263: 11943-11947 (1988)), chick Ng-CAM (Burgoon, M. P., Grumet, M., Mauro, V., Edelman, G. M., Cunningham, B. A., Structure Of The Chicken Neuron-Glial Cell Adhesion Molecule, Ng-CAM: Origin Of The Polypeptides And Relation To The Ig Superfamily. J. Cell Biol. 112: 1017-1029 (1991)) and L1 cam (Sadoul, K., Sadoul, R., Faissner, A., Schachner, M., Biochemical Characterization Of Different Molecular Forms Of The Neural Cell Adhesion Molecule L1. J. Neurochem 50: 510-521 (1988)).

Cell Culture

Functional assays of the L1 CAM purified from human brain were performed by two neuronal culture methods. Dissociated P1 rat cerebellar cells were plated on L1 CAM-nitrocellulose coated plates as previously described by Applicant (Lemmon, V., Farr, K., Lagenaur, C., L1 Mediated Axon outgrowth Occurs Via A Homophilic Binding Mechanism. Neuron 2: 1597-1603 (1989)). E7 chick retinal strips were grown on L1 CAM-nitrocellulose coated plates based on a system developed by Halfter et al. (Halfter, W., Claviez, M., Schwarz, U., Preferential Adhesion Of Tectal Membranes To Anterior Embryonic Chick Retina Neurites. Nature 292: 67-70 (1981)). Plain nitrocellulose coated with bovine serum albumin was used as a negative control substrate.

As shown in FIG. 2, purified L1 CAM was extremely potent in supporting neurite outgrowth. Chick retinal explants produced extended defasciculated neurites on L1CAM (FIG. 2) and dissociated rat cerebellar neurons grew long neurites. Controls grown on nitrocellulose without L1 CAM showed poor attachment and no neurite extension.

Molecular Cloning

A human fetal brain cDNA library in Lambda ZAP.RTM. II (Stratagene, La Jolla, Calif.) was amplified in the E. coli strain XL1 -Blue (Stratagene, La Jolla, Calif.). The library was probed with a .sup.32 P 5' end labelled synthetic degenerate oligonucleotides, 50 nucleotides in length (SEQ ID NO: 7) (i.e. GAGGACACCCAGGTGGACTCTGAGGCCCGACCGATGAAAGATGAGACCTT), corresponding to a region that is highly conserved between L1 cam and the rat homologue NILE glycoprotein (Prince, J. T., Milona, N., Stallcup, W. B., Characterization Of A Partial cDNA Clone For The NILE Glycoprotein And Identification Of The Encoded Polypeptide Domain. J. Neurosci 9: 1825-1834 (1989)). The screening was carried out overnight at 30.degree. C. in a solution containing 6.times.SSC, 5.times.Denhardts, 0.5% SDS (sodium dodecyl sulfate), 20% formamide and 100 ug/ml salmon sperm DNA.

A total of 3.times.10.sup.6 placques were screened, representing a three-fold screening of the library. Twenty placques were initially positive, however only three of the clones initially isolated from the cDNA library remained positive after successive rounds of screening and proved subsequently to correspond to L1CAM cDNA. After excision of the inserts from the phage vector, these clones were determined to be approximately 3.4, 2.6, and 1.4 kb in length by gel diffusion and 3.2, 2.6 and 1.7 kb in length by sequencing and were designated 3.1 (SEQ ID NO: 3), 4 (SEQ ID NO: 4) and 17 (SEQ ID NO: 5) respectively. See FIG. 5. Because none of these contained a start methionine and initial signal sequence, a second screening of the library was performed using a 40 base oligonucleotide (SEQ ID NO: 8) (i.e. TGCCACGCCCACTTCCCAGGCACCAGGACCATCATTCAGA) deduced from sequencing the 5' end of clone 3.1 (SEQ ID NO: 3). A positive clone from this screening, C2 (SEQ ID NO: 6), contained an initiation codon preceded by a stop codon and followed by sequence that corresponded to a hydrophobic stretch of amino acids that is presumed to be a signal sequence, as well as sequence that overlapped with the previously obtained clones. This clone was determined to be 1.2 kb in length by gel diffusion and later about 1.0 kb in length by sequencing.

DNA Sequencing

Double stranded DNA sequencing was carried out by the dideoxynucleotide method (Sanger, F. S., Nicklen, S., Coulson, A. R., DNA Sequencing With Chain Terminating Inhibitors. Proc. Natl. Acad. Sci. USA 74: 5463-5467 (1977)) using a Sequenase Kit (USBC, Cleveland, Ohio) and .sup.35 S-deoxyadenosine 5'-(thio) triphosphate from Amersham, Arlington Heights, Ill. The primers for the reactions were custom synthesized. Sequencing primers to the T7 and T3 promoters were used for the initial sequencing, and subsequent sequencing was done using additional synthetic oligonucleotide primers generated from the newly acquired L1CAM sequence. The complete sequence was obtained from both DNA strands. Sequence analysis was carried out using the MacVector.RTM. (IBI) sequence analysis program.

The nucleotide (lower line) and deduced amino acid (upper line) sequence for the L1CAM cDNA coding region (SEQ ID NO: 2) is shown in FIG. 3A and 3B. The open reading frame encodes a protein of 1,256 amino acids and 142,698 Dalton molecular weight. The nucleotide sequence for L1 CAM (SEQ ID NO: 2) has been deposited with EMBL/GenBank Data Libraries under Accession No. M64296.

The nucleotide sequences of the human L1CAM and mouse L1 cam cDNAs were compared and found to be 85% identical. At the amino acid level, this rose to 92% overall identity (FIG. 4A and 4B).

Structurally, L1-related molecules are similar to other immunoglobulin superfamily cell adhesion molecules having a motif of repeating immunoglobulin domains followed by fibronectin type III domains. The L1 -like molecules in particular have 6 repeating immunoglobulin C2 (Ig) domains followed by 5 repeating fibronectin type III (Fn) domains (Moos, M., Tacke, R., Scherer, H., Teplow, D., Fruh, K., Schachner, M., Neural Adhesion Molecule L1 As A Member Of The Immunoglobulin Superfamily With Binding Domains Similar To Fibronectin. Nature 334: 701-703 (1988); and, Burgoon, M. P., Grumet, M., Mauro, V., Edelman, G. M., Cunningham, B. A., Structure Of The Chicken Neuron-Glial Cell Adhesion Molecule, Ng-CAM: Origin Of The Polypeptides And Relation To The Ig Superfamily. J. Cell Biol. 112: 1017-1029 (1991)). These are linked to a cytoplasmic portion of the molecule by a transmembrane domain.

A domain by domain comparison of the protein sequence of human L1CAM to mouse L1 cam, chick Ng-CAM, and Drosophila neuroglian was performed and is summarized below in Table 1.

TABLE 1 __________________________________________________________________________ Percentage Identity of Amino Acids in Different Domains Compared to Human L1 Domain Ig 1 Ig 2 Ig 3 Ig 4 Ig 5 Ig 6 Fn 1 Fn 2 Fn 3 Fn 4 Fn 5 TM CP __________________________________________________________________________ ML1cam 83 93 91 87 90 93 89 89 86 82 75 94 100 NGCAM 44 66 55 57 39 43 38 56 33 30 18 78 63 NGCAM* 62 83 71 79 66 56 67 73 58 49 32 100 75 Neuroglian 26 32 27 24 29 32 32 36 31 29 18 22 26 Neuroglian* 41 54 47 49 49 48 51 68 50 52 40 67 40 __________________________________________________________________________

As indicated above, two short stretches of L1CAM nucleotide sequence have been published previously. A comparison of the genomic sequence obtained by Dijalbi. et al. (Djabali, M., Mattei, M. G., Nguyen, C., Roux, D., Demengeot, J., Denizot, F., Moos, M., Schachner, M., Goridis, C., Jordan, B. R., The Gene Encoding L1 , A Neural Adhesion Molecule Of The Immunoglobulin Family, Is Located On The X-Chromosome In Mouse And Man. Genomics 7: 587-593 (1990)) with Applicants is an identical match from nucleotides 991-1091. See FIG. 3A and 3B. The first 23 nucleotides of the Dijalbi sequence, however, did not match Applicants sequence or the L1 cam sequence and likely represents an intron.

The sequence obtained by Harper et al. (Harper, J. R., Prince, J. T., Healy, P. A., Stuart, J. K., Nauman, S. J., Stallcup, W. B., Isolation And Sequence Of Partial cDNA Clones Of Human-L1 - Homology Of Human And Rodent-L1 In The Cytoplasmic Region. J Neurochem 56: 797-804 (1991)) from human melanoma cDNA differs from Applicants at L1CAM nucleotides 3528 to 3540 where Harper et al. show a 12 nucleotide deletion. See FIGS. 3A and 3B. Applicants obtained identical sequence for this region from three independent clones and the sequence matches the corresponding mouse nucleotide sequence perfectly. This discrepancy could represent a mutation in the tumor line or a splicing variant. The sequence also varies between nucleotides 3344-3349 where Harper et al. have an extra 3 nucleotides introduced non-sequentially. Interestingly, Applicants found a one amino acid deletion here as compared to the mouse L1 cam sequence with matching of the flanking amino acids on either side. This region was particularly difficult to sequence on the anti-sense strand, requiring dITP reactions to resolve compressions. The coding strand, however, had unambiguous sequence. Applicants found a final difference at base 3086 where Applicants have an A.

A comparison of the sequences of human L1CAM and mouse L1 cam with Ng-CAM in FIG. 4A and 4B raises a question about the relationship between mammalian L1 and Ng-CAM: are they homologous? Burgoon et al. have suggested that Ng-CAM may not be "equivalent" to L1 due to the relatively low sequence (40%) identity between the two molecules (Burgoon, M. P., Grumet, M., Mauro, V., Edelman, G. M., Cunningham, B. A., Structure Of The Chicken Neuron-Glial Cell Adhesion Molecule, Ng-CAM: Origin Of The Polypeptides And Relation To The Ig Superfamily. J. Cell Biol. 112: 1017-1029 (1991)). In contrast, mouse NCAM is about 80% identical with chick NCAM and rat fibronectin is about 80% identical with chick fibronectin. They also state that "experiments to identify an L1 homologue in chickens and an Ng-CAM homologue in mice have not yet revealed such molecules".

Despite the poor sequence homology between Ng-CAM and mammalian L1 , there are many similarities among the molecules. If conservative amino acid substitutions in Ng-CAM are permitted, the overall similarity between L1CAM and Ng-CAM rises to 66%. The Ig domains show relatively higher degrees of similarity, up to 83%, with 75% conservation of the cytoplasmic domain. Furthermore, the overall structure of the molecule is preserved from species to species; there are 6 Ig domains and 5 Fn domains in each molecule and each structural domain in the chick molecule is most closely related to the same domain in the human. The domains that show the highest degree of similarity between human and mouse (Ig 2, Fn 2, the transmembrane and cytoplasmic domain) also demonstrate the most similarity between human and chick. The relatively variable domains between human L1 CAM and mouse L1 cam (Ig 1, Fn 4 and Fn 5) also have relatively low homologies between human and chick. This is also true when comparing L1 CAM to Drosophila neuroglian.

Immunological and biochemical experiments demonstrate many similarities between mammalian L1 and Ng-CAM. Antibodies against mammalian L1 from different species crossreact with Ng-CAM. Purification of L1 and Ng-CAM from brain produces a similar polypeptide pattern on SDS-PAGE and there is substantial evidence that there are protease sensitive sites at the same two locations in both L1 and Ng-CAM (Sadoul, R., Kirchhoff, F., Schachner, M., A Protein Kinase Activity Is Associated With And Specifically Phosphorylates The Neural Cell Adhesion Molecule L1 . J. Neurochem. 53: 1471-1478 (1988); Prince, J. T., Milona, N., Stallcup, W. B., Characterization Of A Partial cDNA Clone For The NILE Glycoprotein And Identification Of The Encoded Polypeptide Domain. J. Neurosci. 9: 1825-1834 (1989); and, Burgoon, M. P., Grumet, M., Mauro, V., Edelman, G. M., Cunningham, B. A., Structure Of The Chicken Neuron-Glial Cell Adhesion Molecule, Ng-CAM: Origin Of The Polypeptides And Relation To The Ig Superfamily. J. Cell Biol. 112: 1017-1029 (1991)). The anatomical distribution of L1 , despite minor variations, shows striking similarity between chick and mammals. For example, almost all projection axons in the CNS and PNS express L1 or Ng-CAM in the corresponding species.

Functional experiments have shown that anti-L1 and anti-Ng-CAM antibodies disrupt axon fasciculation in both chicks and mammals (Stallcup, W. B., Beasley, L., Involvement Of The Nerve Growth Factor-Inducible Large External Glycoprotein (NILE) In Neurite Fasciculation In Primary Cultures Of Rat Brain. Proc. Natl. Acad. Sci. USA 82: 1276-1280 (1985); and, Rathjen, F. G., Schachner, M., Immunocytological And Biochemical Characterization Of A New Neuronal Cell Surface Component (L1 Antigen) Which Is Involved In Cell Adhesion. EMBO J. 3: 1-10 (1984)) and inhibit neuron-neuron adhesion (Keilhauer, G., Faissner, A., Schachner, M., Differential Inhibition Of Neurone-Neurone, Neurone-Astrocyte and Astrocyte-Astrocyte Adhesion By L1 , L2 And N-CAM Antibodies. Nature 316: 728-730 (1985); Grumet, M., Hoffman, S. ,Edelman, G. M., Two Antigenically Related Neuronal Cell Adhesion Molecules Of Different Specificities Mediate Neuron-Neuron And Neuron-Glia Adhesion. Proc. Natl. Acad. Sci. USA 81: 267-271 (1984)). They also perturb migration of granule cells from the external granule cell layer to the internal granule cell layer in the cerebellum (Lindner, J., Rathjen, F. G., Schachner, M., L1 mono- and polyclonal antibodies modify cell migration in early postnatal mouse cerebellum. Nature 305: 427-430 (1983); and, Hoffman, S., Friedlander, D. R., Chuong, C.-M., Grumet, M., Edelman, G. M., Differential Contributions Of Ng-CAM And N-CAM To Cell Adhesion In Different Neural Regions. J. Cell Biol. 103: 145-158. (1986)).

Finally, studies with purified L1 and with Ng-CAM show that mammalian cells can bind to chick Ng-CAM and that chick neurons can bind to mammalian L1 in a homophilic binding interaction between the L1 cam and the chick Ng-CAM (Lemmon, V., Farr, K., Lagenaur, C., L1 Mediated Axon Outgrowth Occurs Via A Homophilic Binding Mechanism. Neuron 2: 1597-1603 (1989)). Therefore, while there are clearly structural differences between Ng-CAM and L1 it seems most likely that they represent homologous and not merely analogous molecules.

Comparison of L1 CAM, L1 cam, rat NILE and chick Ng-CAM confirms previous reports that the cytoplasmic portion of this molecule is very highly conserved, suggesting an important functional role for this region of the molecule (Prince, J. T., Milona, N., Stallcup, W. B., Characterization Of A Partial cDNA Clone For The NILE Glycoprotein And Identification Of The Encoded Polypeptide Domain. J. Neurosci. 9: 1825-1834 (1989); and, Harper, J. R., Prince, J. T., Healy, P. A., Stuart, J. K., Nauman, S. J., Stallcup, W. B., Isolation And Sequence Of Partial cDNA Clones of Human-L1- Homology Of Human And Rodent-L1 In The Cytoplasmic Region. J. Neurochem 56: 797-804 (1991)). Evidence points to an interaction of L1 with the cytoskeleton, directly or indirectly, because in differentiated neuroblastomas L1 is relatively immobile (Pollerberg, G. E., Davoust, J., Schachner, M., Lateral Mobility Of The Cell Adhesion Molecule-L1 Within The Surface Membrane Of Morphologically Undifferentiated And Differentiated Neuroblastoma Cells. European Journal of Neuroscience 2: 712-717 (1990)).

However, on axons and growth cones of chick retinal ganglion cells, L1 is freely diffusible (Drazba, J., Lemmon, V., Cell adhesion molecules 8D9 and NCAM move independently in the plane of axon membranes. Soc. for Neurosci., St. Louis, Mo., (1990)). This suggests that attachment to the cytoskeleton is not a prerequisite for functional binding as is the case for cadherins (Nagafuchi, A., Takeichi, M., Cell binding function of E-cadherin is regulated by the cytoplasmic domain. EMBO J. 7: 3679-3684 (1988)).

The cytoplasmic domain of L1 also may be involved in regulating cell adhesion molecule function. L1 is phosphorylated and is associated with a casein kinase (Sadoul, R., Kirchhoff, F., Schachner, M., A Protein Kinase Activity Is Associated With And Specifically Phosphorylates The Neural Cell Adhesion Molecule L1 . J. Neurochem. 53: 1471-1478 (1988)). Anti-L1 antibody binding to L1 on has been shown to alter intracellular calcium and pH (Schuch, U., Lohse, M. J., Schachner, M., Neural Cell Adhesion Molecules Influence Second Messenger Systems. Neuron (1989)). Agents such as TPA or okadaic acid that increase cytoplasmic phosphorylation increase fasciculation in a manner consistent with increased affinity of L1 for its ligand (Cervello, M. Lemmon, V., Landreth, G., and Rutishauser, U., Phosphorylation - dependent regulation of neurite fasciculation. Proc. Natl. Acad. Sci., U.S.A., 88: 10548-10552 (1991)). This evidence indicates that L1 either regulates cell function or has its function regulated via its cytoplasmic region.

Interspecies comparison of the amino acid sequence of the extracellular portion of L1 suggests that the Ig domain 2 and Fn domain 2 may have some conserved function since these are the immunoglobulin and fibronectin domains with greatest homology. One possibility is that the Ig domain 2 is important in L1-L1 homophilic binding. The Ig domains 2 and 3 of NCAM are believed to be involved in heparin and cell binding (Frelinger, A. L., Rutishauser, U., Topography of N-CAM Structural And Functional Determinants II. Placement Of Monoclonal Antibody Epitopes. J. Cell Biol. 103: 1729-1737 (1986); and, Cole, G. J., Akeson, R., Identification If A Heparin Binding Domain Of The Neural Cell Adhesion Molecule N-CAM Using Synthetic Peptides. Neuron 2: 1157-1165 (1989)). This demonstrates that Ig superfamily molecules do not necessarily bind amino terminus to amino terminus. It is also possible that a large region of L1 is involved in L1-L1 binding, similar to the manner in which Ig heavy chains bind to each other; according to this model, the L1 Ig domains would bind in a long parallel or anti-parallel interaction.

This possibility is consistent with the report that all monoclonal antibodies to G4 (thought to be identical with chick Ng-CAM) that were tested were able to inhibit G4-G4 binding (Chang, S., Rathjen, F. G., Raper, J. A., Neurite Outgrowth Promoting Activity Of G4 And Its Inhibition By Monoclonal Antibodies. J Neurosc R 25: 180-186 (1990)). No highly positively charged regions were observed in any of the Ig domains that would be analogous to the heparin binding domain in the second Ig domain of NCAM (Cole, G. J., Akeson, R., Identification Of A Heparin Binding Domain Of The Neural Cell Adhesion Molecule N-CAM Using Synthetic Peptides. Neuron 2: 1157-1165 (1989)). However, the second Ig domain of L1 and Ng-CAM does have a highly negatively charged region with 4 out of 6 amino acids being aspartic acid or glutamic acid. The third Fn domain of L1 has one region with 9 out of 12 positively charged amino acids. A similar region is present in L1 cam but is absent from chick. Conclusions about structure-function relations must await more detailed experiments using well defined antibodies and mutated forms of L1.

The information provided above extends previous work by providing the entire coding sequence of human L1 CAM and demonstrating that like the related molecules in mouse, rat and chick, L1CAM purified from human brain can support neurite growth. The structural knowledge gained allows comparisons with nearby and more distant species, mice, chick and Drosophila and speculation about structurally important areas of the molecule. The results of in vitro testing of natural L1CAM support the idea that L1CAM is likely to be an important molecule in the development of the human nervous system by providing evidence that L1CAM can mediate neurite growth. This complements reports that the human L1 gene is on the X chromosome in a region were disease of CNS axonal tract development has been mapped (Djabali et al., 1990), and strengthens the need for further understanding of the molecule. Use of the cDNA will enable comparison of recombinant L1CAM with the product purified from human brain and permit functional studies on the recombinant molecule in vitro. Moreover, using the cDNA, cell lines can be constructed expressing normal and altered L1CAM for use in transplantation or regeneration studies.

Furthermore, as a result of the isolation and complete characterization of the nucleotide sequence, the present invention is also directed to the use of the nucleotide sequence (SEQ ID NO: 2) and/or the cDNA clones thereof (SEQ ID NOS: 3-6), for tests that can be used to determine genetic or acquired disorders of neuronal cells using L1CAM DNA probes specific for the identified nucleotide sequence (or DNA fragments thereof) or antibodies to the products coded by the nucleotide sequence or cDNA. More particularly, such uses include a method for identifying the gene coding for the L1CAM which comprises hybridizing a cDNA which codes for part of the L1CAM with human genomic DNA, and determining whether the cDNA anneals to the genomic DNA.

In addition, the present invention relates to the use of gene fragments generated through amplification from human genomic or cloned DNA for detection and analysis of the gene, such as in the detection of mutations. The gene can be used for the production of L1CAM protein. A method for amplifying a nucleotide sequence specific for the human gene for the L1CAM from biological samples containing human genomic DNA using the synthetic oligonucleotide primers of the present invention which contain either a nucleotide sequence from the gene or from the cDNAs encoding exons of the gene (i.e. L1CAM gene), such a method would comprise the steps of synthesizing the oligonucleotides containing the nucleotide sequence wherein the nucleotide sequence are specific for the gene for the L1CAM, allowing the oligonucleotides to anneal to the specific sequences in the sample containing the human genomic DNA, synthesizing a copy of each strand of the DNA by polymerase chain reaction, and denaturing the sample to separate the DNA strands from each other.

Moreover, as elaborated above, the present invention also relates to the potential use of the nucleotide sequence synthesized above for cloning purposes. Other alterative embodiments for new and unique uses of nucleotide sequences, the cDNA clones, etc. may be utilized by procedures that are well known in the art.

The invention has been described with reference to the preferred embodiments. Obviously, modifications and alterations will occur to others upon reading and understanding the preceding detailed description. It is intended that the present invention includes all such alterations and modifications insofar as they come within the scope of the appended claims or the equivalents thereof.

__________________________________________________________________________ # SEQUENCE LISTING - - - - (1) GENERAL INFORMATION: - - (iii) NUMBER OF SEQUENCES: 44 - - - - (2) INFORMATION FOR SEQ ID NO: 1: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 3774 (B) TYPE: nucleic acid (C) STRANDEDNESS: sing - #le (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: nucleic acids - - (iii) HYPOTHETICAL: irrelevant - - (iv) ANTI-SENSE: no - - (vi) ORIGINAL SOURCE: (A) ORGANISM: Homo Sapi - #ens (B) INDIVIDUAL ISOLATE: - #17-18 week fetus - - (vii) IMMEDIATE SOURCE: (A) LIBRARY: Stratagene - #cDNA Library 936206 (B) CLONE: synthesis of - # 4 clones - - (x) PUBLICATION INFORMATION: (A) AUTHORS: - # Hlavin, Mary Louise Lemmon, V - #ance (B) TITLE: - # Molecular structure and functional testing o - #f human L1CAM: an interspecies - # comparison. (C) JOURNAL: - # GENOMICS (D) VOLUME: - # 11 (E) ISSUE: (F) PAGES: - # 416-423 (G) DATE: - # 1991 (K) RELEVANT RESIDUES I - #N SEQ ID NO: 1 to 3774 - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO: - # 1: - - ATG GTC GTG GCG CTG CGG TAC GTG TGG CCT CT - #C CTC CTC TGC AGC CCC 48 Met Val Val Ala Leu Arg Tyr Val Trp Pro Le - #u Leu Leu Cys Ser Pro 1 5 - # 10 - # 15 - - TGC CTG CTT ATC CAG ATC CCC GAG GAA TAT GA - #A GGA CAC CAT GTG ATG 96 Cys Leu Leu Ile Gln Ile Pro Glu Glu Tyr Gl - #u Gly His His Val Met 20 - # 25 - # 30 - - GAG CCA CCT GTC ATC ACG GAA CAG TCT CCA CG - #G CGC CTG GTT GTC TTC 144 Glu Pro Pro Val Ile Thr Glu Gln Ser Pro Ar - #g Arg Leu Val Val Phe 35 - # 40 - # 45 - - CCC ACA GAT GAC ATC AGC CTC AAG TGT GAG GC - #C AGT GGC AAG CCC GAA 192 Pro Thr Asp Asp Ile Ser Leu Lys Cys Glu Al - #a Ser Gly Lys Pro Glu 50 - # 55 - # 60 - - GTG CAG TTC CGC TGG ACG AGG GAT GGT GTC CA - #C TTC AAA CCC AAG GAA 240 Val Gln Phe Arg Trp Thr Arg Asp Gly Val Hi - #s Phe Lys Pro Lys Glu 65 70 - # - # 75 - # 80 - - GAG CTG GGT GTG ACC GTG TAC CAG TCG CCC CA - #C TCT GGC TCC TTC ACC 288 Glu Leu Gly Val Thr Val Tyr Gln Ser Pro Hi - #s Ser Gly Ser Phe Thr 85 - # 90 - # 95 - - ATC ACG GGC AAC AAC AGC AAC TTT GCT CAG AG - #G TTC CAG GGC ATC TAC 336 Ile Thr Gly Asn Asn Ser Asn Phe Ala Gln Ar - #g Phe Gln Gly Ile Tyr 100 - # 105 - # 110 - - CGC TGC TTT GCC AGC AAT AAG CTG GGC ACC GC - #C ATG TCC CAT GAG ATC 384 Arg Cys Phe Ala Ser Asn Lys Leu Gly Thr Al - #a Met Ser His Glu Ile 115 - # 120 - # 125 - - CGG CTC ATG GCC GAG GGT GCC CCC AAG TGG CC - #A AAG GAG ACA GTG AAG 432 Arg Leu Met Ala Glu Gly Ala Pro Lys Trp Pr - #o Lys Glu Thr Val Lys 130 - # 135 - # 140 - - CCC GTG GAG GTG GAG GAA GGG GAG TCA GTG GT - #T CTG CCT TGC AAC CCT 480 Pro Val Glu Val Glu Glu Gly Glu Ser Val Va - #l Leu Pro Cys Asn Pro 145 1 - #50 1 - #55 1 - #60 - - CCC CCA AGT GCA GAG CCT CTC CGG ATC TAC TG - #G ATG AAC AGC AAG ATC 528 Pro Pro Ser Ala Glu Pro Leu Arg Ile Tyr Tr - #p Met Asn Ser Lys Ile 165 - # 170 - # 175 - - TTG CAC ATC AAG CAG GAC GAG CGG GTG ACG AT - #G GGC CAG AAC GGC AAC 576 Leu His Ile Lys Gln Asp Glu Arg Val Thr Me - #t Gly Gln Asn Gly Asn 180 - # 185 - # 190 - - CTC TAC TTT GCC AAT GTG CTC ACC TCC GAC AA - #C CAC TCA GAC TAC ATC 624 Leu Tyr Phe Ala Asn Val Leu Thr Ser Asp As - #n His Ser Asp Tyr Ile 195 - # 200 - # 205 - - TGC CAC GCC CAC TTC CCA GGC ACC AGG ACC AT - #C ATT CAG AAG GAA CCC 672 Cys His Ala His Phe Pro Gly Thr Arg Thr Il - #e Ile Gln Lys Glu Pro 210 - # 215 - # 220 - - ATT GAC CTC CGG GTC AAG GCC ACC AAC AGC AT - #G ATT GAC AGG AAG CCG 720 Ile Asp Leu Arg Val Lys Ala Thr Asn Ser Me - #t Ile Asp Arg Lys Pro 225 2 - #30 2 - #35 2 - #40 - - CGC CTG CTC TTC CCC ACC AAC TCC AGC AGC CA - #C CTG GTG GCC TTG CAG 768 Arg Leu Leu Phe Pro Thr Asn Ser Ser Ser Hi - #s Leu Val Ala Leu Gln 245 - # 250 - # 255 - - GGG CAG CCA TTG GTC CTG GAG TGC ATC GCC GA - #G GGC TTT CCC ACG CCC 816 Gly Gln Pro Leu Val Leu Glu Cys Ile Ala Gl - #u Gly Phe Pro Thr Pro 260 - # 265 - # 270 - - ACC ATC AAA TGG CTG CGC CCC AGT GGC CCC AT - #G CCA GCT GAC CGT GTC 864 Thr Ile Lys Trp Leu Arg Pro Ser Gly Pro Me - #t Pro Ala Asp Arg Val 275 - # 280 - # 285 - - ACC TAC CAG AAC CAC AAC AAG ACC CTG CAG CT - #G CTG AAA GTG GGC GAG 912 Thr Tyr Gln Asn His Asn Lys Thr Leu Gln Le - #u Leu Lys Val Gly Glu 290 - # 295 - # 300 - - GAG GAT GAT GGC GAG TAC CGC TGC CTG GCC GA - #G AAC TCA CTG GGC AGT 960 Glu Asp Asp Gly Glu Tyr Arg Cys Leu Ala Gl - #u Asn Ser Leu Gly Ser 305 3 - #10 3 - #15 3 - #20 - - GCC CGG CAT GCG TAC TAT GTC ACC GTG GAG GC - #T GCC CCG TAC TGG CTG 1008 Ala Arg His Ala Tyr Tyr Val Thr Val Glu Al - #a Ala Pro Tyr Trp Leu 325 - # 330 - # 335 - - CAC AAG CCC CAG AGC CAT CTA TAT GGG CCA GG - #A GAG ACT GCC CGC CTG 1056 His Lys Pro Gln Ser His Leu Tyr Gly Pro Gl - #y Glu Thr Ala Arg Leu 340 - # 345 - # 350 - - GAC TGC CAA GTC CAG GGC AGG CCC CAA CCA GA - #G GTC ACC TGG AGA ATC 1104 Asp Cys Gln Val Gln Gly Arg Pro Gln Pro Gl - #u Val Thr Trp Arg Ile 355 - # 360 - # 365 - - AAC GGG ATC CCT GTG GAG GAG CTG GCC AAA GA - #C CAG AAG TAC CGG ATT 1152 Asn Gly Ile Pro Val Glu Glu Leu Ala Lys As - #p Gln Lys Tyr Arg Ile 370 - # 375 - # 380 - - CAG CGT GGC GCC CTG ATC CTG AGC AAC GTG CA - #G CCC AGT GAC ACA ATG 1200 Gln Arg Gly Ala Leu Ile Leu Ser Asn Val Gl - #n Pro Ser Asp Thr Met 385 3 - #90 3 - #95 4 - #00 - - GTG ACC CAA TGT GAG GCC CGC AAC CGG CAC GG - #G CTC TTG CTG GCC AAT 1248 Val Thr Gln Cys Glu Ala Arg Asn Arg His Gl - #y Leu Leu Leu Ala Asn 405 - # 410 - # 415 - - GCC TAC ATC TAC GTT GTC CAG CTG CCA GCC AA - #G ATC CTG ACT GCG GAC 1296 Ala Tyr Ile Tyr Val Val Gln Leu Pro Ala Ly - #s Ile Leu Thr Ala Asp 420 - # 425 - # 430 - - AAT CAG ACG TAC ATG GCT GTC CAG GGC AGC AC - #T GCC TAC CTT CTG TGC 1344 Asn Gln Thr Tyr Met Ala Val Gln Gly Ser Th - #r Ala Tyr Leu Leu Cys 435 - # 440 - # 445 - - AAG GCC TTC GGA GCG CCT GTG CCC AGT GTT CA - #G TGG CTG GAC GAG GAT 1392 Lys Ala Phe Gly Ala Pro Val Pro Ser Val Gl - #n Trp Leu Asp Glu Asp 450 - # 455 - # 460 - - GGG ACA ACA GTG CTT CAG GAC GAA CGC TTC TT - #C CCC TAT GCC AAT GGG 1440 Gly Thr Thr Val Leu Gln Asp Glu Arg Phe Ph - #e Pro Tyr Ala Asn Gly 465 4 - #70 4 - #75 4 - #80 - - ACC CTG GGC ATT CGA GAC CTC CAG GCC AAT GA - #C ACC GGA CGC TAC TTC 1488 Thr Leu Gly Ile Arg Asp Leu Gln Ala Asn As - #p Thr Gly Arg Tyr Phe 485 - # 490 - # 495 - - TGC CTG GCT GCC AAT GAC CAA AAC AAT GTT AC - #C ATC ATG GCT AAC CTG 1536 Cys Leu Ala Ala Asn Asp Gln Asn Asn Val Th - #r Ile Met Ala Asn Leu 500 - # 505 - # 510 - - AAG GTT AAA GAT GCA ACT CAG ATC ACT CAG GG - #G CCC CGC AGC ACA ATC 1584 Lys Val Lys Asp Ala Thr Gln Ile Thr Gln Gl - #y Pro Arg Ser Thr Ile 515 - # 520 - # 525 - - GAG AAG AAA GGT TCC AGG GTG ACC TTC ACG TG - #C CAG GCC TCC TTT GAC 1632 Glu Lys Lys Gly Ser Arg Val Thr Phe Thr Cy - #s Gln Ala Ser Phe Asp 530 - # 535 - # 540 - - CCC TCC TTG CAG CCC AGC ATC ACC TGG CGT GG - #G GAC GGT CGA GAC CTC 1680 Pro Ser Leu Gln Pro Ser Ile Thr Trp Arg Gl - #y Asp Gly Arg Asp Leu 545 5 - #50 5 - #55 5 - #60 - - CAG GAG CTT GGG GAC AGT GAC AAG TAC TTC AT - #A GAG GAT GGG CGC CTG 1728 Gln Glu Leu Gly Asp Ser Asp Lys Tyr Phe Il - #e Glu Asp Gly Arg Leu 565 - # 570 - # 575 - - GTC ATC CAC AGC CTG GAC TAC AGC GAC CAG GG - #C AAC TAC AGC TGC GTG 1776 Val Ile His Ser Leu Asp Tyr Ser Asp Gln Gl - #y Asn Tyr Ser Cys Val 580 - # 585 - # 590 - - GCC AGT ACC GAA CTG GAT GTG GTG GAG AGT AG - #G GCA CAG CTC TTG GTG 1824 Ala Ser Thr Glu Leu Asp Val Val Glu Ser Ar - #g Ala Gln Leu Leu Val 595 - # 600 - # 605 - - GTG GGG AGC CCT GGG CCG GTG CCA CGG CTG GT - #G CTG TCC GAC CTG CAC 1872 Val Gly Ser Pro Gly Pro Val Pro Arg Leu Va - #l Leu Ser Asp Leu His 610 - # 615 - # 620 - - CTG CTG ACG CAG AGC CAG GTG CGC GTG TCC TG - #G AGT CCT GCA GAA GAC 1920 Leu Leu Thr Gln Ser Gln Val Arg Val Ser Tr - #p Ser Pro Ala Glu Asp 625 6 - #30 6 - #35 6 - #40 - - CAC AAT GCC CCC ATT GAG AAA TAT GAC ATT GA - #A TTT GAG GAC AAG GAA 1968 His Asn Ala Pro Ile Glu Lys Tyr Asp Ile Gl - #u Phe Glu Asp Lys Glu 645 - # 650 - # 655 - - ATG GCG CCT GAA AAA TGG TAC AGT CTG GGC AA - #G GTT CCA GGG AAC CAG 2016 Met Ala Pro Glu Lys Trp Tyr Ser Leu Gly Ly - #s Val Pro Gly Asn Gln 660 - # 665 - # 670 - - ACC TCT ACC ACC CTC AAG CTG TCG CCC TAT GT - #C CAC TAC ACC TTT AGG 2064 Thr Ser Thr Thr Leu Lys Leu Ser Pro Tyr Va - #l His Tyr Thr Phe Arg 675 - # 680 - # 685 - - GTT ACT GCC ATA AAC AAA TAT GGC CCC GGG GA - #G CCC AGC CCG GTC TCT 2112 Val Thr Ala Ile Asn Lys Tyr Gly Pro Gly Gl - #u Pro Ser Pro Val Ser 690 - # 695 - # 700 - - GAG ACT GTG GTC ACA CCT GAG GCA GCC CCA GA - #G AAG AAC CCT GTG GAT 2160 Glu Thr Val Val Thr Pro Glu Ala Ala Pro Gl - #u Lys Asn Pro Val Asp 705 7 - #10 7 - #15 7 - #20 - - GTG AAG GGG GAA GGA AAT GAG ACC ACC AAT AT - #G GTC ATC ACG TGG AAG 2208 Val Lys Gly Glu Gly Asn Glu Thr Thr Asn Me - #t Val Ile Thr Trp Lys 725 - # 730 - # 735 - - CCG CTC CGG TGG ATG GAC TGG AAC GCC CCC CA - #G GTT CAG TAC CGC GTG 2256 Pro Leu Arg Trp Met Asp Trp Asn Ala Pro Gl - #n Val Gln Tyr Arg Val 740 - # 745 - # 750 - - CAG TGG CGC CCT CAG GGG ACA CGA GGG CCC TG - #G CAG GAG CAG ATT GTC 2304 Gln Trp Arg Pro Gln Gly Thr Arg Gly Pro Tr - #p Gln Glu Gln Ile Val 755 - # 760 - # 765 - - AGC GAC CCC TTC CTG GTG GTG TCC AAC ACG TC - #C ACC TTC GTG CCC TAT 2352 Ser Asp Pro Phe Leu Val Val Ser Asn Thr Se - #r Thr Phe Val Pro Tyr 770 - # 775 - # 780 - - GAG ATC AAA GTC CAG GCC GTC AAC AGC CAG GG - #C AAG GGA CCA GAG CCC 2400 Glu Ile Lys Val Gln Ala Val Asn Ser Gln Gl - #y Lys Gly Pro Glu Pro 785 7 - #90 7 - #95 8 - #00 - - CAG GTC ACT ATC GGC TAC TCT GGA GAG GAC TA - #C CCC CAG GCA ATC CCT 2448 Gln Val Thr Ile Gly Tyr Ser Gly Glu Asp Ty - #r Pro Gln Ala Ile Pro 805 - # 810 - # 815 - - GAG CTG GAA GGC ATT GAA ATC CTC AAC TCA AG - #T GCC GTG CTG GTC AAG 2496 Glu Leu Glu Gly Ile Glu Ile Leu Asn Ser Se - #r Ala Val Leu Val Lys 820 - # 825 - # 830 - - TGG CGG CCG GTG GAC CTG GCC CAG GTC AAG GG - #C CAC CTC CGC GGA TAC 2544

Trp Arg Pro Val Asp Leu Ala Gln Val Lys Gl - #y His Leu Arg Gly Tyr 835 - # 840 - # 845 - - AAT GTG ACG TAC TGG AGG GAG GGC AGT CAG AG - #G AAG CAC AGC AAG AGA 2592 Asn Val Thr Tyr Trp Arg Glu Gly Ser Gln Ar - #g Lys His Ser Lys Arg 850 - # 855 - # 860 - - CAT ATC CAC AAA GAC CAT GTG GTG GTG CCC GC - #C AAC ACC ACC AGT GTC 2640 His Ile His Lys Asp His Val Val Val Pro Al - #a Asn Thr Thr Ser Val 865 8 - #70 8 - #75 8 - #80 - - ATC CTC AGT GGC TTG CGG CCC TAT AGC TCC TA - #C CAC CTG GAG GTG CAG 2688 Ile Leu Ser Gly Leu Arg Pro Tyr Ser Ser Ty - #r His Leu Glu Val Gln 885 - # 890 - # 895 - - GCC TTT AAC GGG CGA GGA TCG GGG CCC GCC AG - #C GAG TTC ACC TTC AGC 2736 Ala Phe Asn Gly Arg Gly Ser Gly Pro Ala Se - #r Glu Phe Thr Phe Ser 900 - # 905 - # 910 - - ACC CCA GAG GGA GTG CCT GGC CAC CCC GAG GC - #G TTG CAC CTG GAG TGC 2784 Thr Pro Glu Gly Val Pro Gly His Pro Glu Al - #a Leu His Leu Glu Cys 915 - # 920 - # 925 - - CAG TCG AAC ACC AGC CTG CTG CTG CGC TGG CA - #G CCC CCA CTC AGC CAC 2832 Gln Ser Asn Thr Ser Leu Leu Leu Arg Trp Gl - #n Pro Pro Leu Ser His 930 - # 935 - # 940 - - AAC GGC GTG CTC ACC GGC TAC GTG CTC TCC TA - #C CAC CCC CTG GAT GAG 2880 Asn Gly Val Leu Thr Gly Tyr Val Leu Ser Ty - #r His Pro Leu Asp Glu 945 9 - #50 9 - #55 9 - #60 - - GGG GGC AAG GGG CAA CTG TCC TTC AAC CTT CG - #G GAC CCC GAA CTT CGG 2928 Gly Gly Lys Gly Gln Leu Ser Phe Asn Leu Ar - #g Asp Pro Glu Leu Arg 965 - # 970 - # 975 - - ACA CAC AAC CTG ACC GAT CTC AGC CCC CAC CT - #G CGG TAC CGC TTC CAG 2976 Thr His Asn Leu Thr Asp Leu Ser Pro His Le - #u Arg Tyr Arg Phe Gln 980 - # 985 - # 990 - - CTT CAG GCC ACC ACC AAA GAG GGC CCT GGT GA - #A GCC ATC GTA CGG GAA 3024 Leu Gln Ala Thr Thr Lys Glu Gly Pro Gly Gl - #u Ala Ile Val Arg Glu 995 - # 1000 - # 1005 - - GGA GGC ACT ATG GCC TTG TCT GGG ATC TCA GA - #T TTT GGC AAC ATC TCA 3072 Gly Gly Thr Met Ala Leu Ser Gly Ile Ser As - #p Phe Gly Asn Ile Ser 1010 - # 1015 - # 1020 - - GCC ACA GCG GGT GAA AAC TAC AGT GTC GTC TC - #C TGG GTC CCC AAG GAG 3120 Ala Thr Ala Gly Glu Asn Tyr Ser Val Val Se - #r Trp Val Pro Lys Glu 1025 1030 - # 1035 - # 1040 - - GGC CAG TGC AAC TTC AGG TTC CAT ATC TTG TT - #C AAA GCC TTG GGA GAA 3168 Gly Gln Cys Asn Phe Arg Phe His Ile Leu Ph - #e Lys Ala Leu Gly Glu 1045 - # 1050 - # 1055 - - GAG AAG GGT GGG GCT TCC CTT TCG CCA CAG TA - #T GTC AGC TAC AAC CAG 3216 Glu Lys Gly Gly Ala Ser Leu Ser Pro Gln Ty - #r Val Ser Tyr Asn Gln 1060 - # 1065 - # 1070 - - AGC TCC TAC ACG CAG TGG GAC CTG CAG CCT GA - #C ACT GAC TAC GAG ATC 3264 Ser Ser Tyr Thr Gln Trp Asp Leu Gln Pro As - #p Thr Asp Tyr Glu Ile 1075 - # 1080 - # 1085 - - CAC TTG TTT AAG GAG AGG ATG TTC CGG CAC CA - #A ATG GCT GTG AAG ACC 3312 His Leu Phe Lys Glu Arg Met Phe Arg His Gl - #n Met Ala Val Lys Thr 1090 - # 1095 - # 1100 - - AAT GGC ACA GGC CGC GTG AGG CTC CCT CCT GC - #T GGC TTC GCC ACT GAG 3360 Asn Gly Thr Gly Arg Val Arg Leu Pro Pro Al - #a Gly Phe Ala Thr Glu 1105 1110 - # 1115 - # 1120 - - GGC TGG TTC ATC GGC TTT GTG AGT GCC ATC AT - #C CTC CTG CTC CTC GTC 3408 Gly Trp Phe Ile Gly Phe Val Ser Ala Ile Il - #e Leu Leu Leu Leu Val 1125 - # 1130 - # 1135 - - CTG CTC ATC CTC TGC TTC ATC AAG CGC AGC AA - #G GGC GGC AAA TAC TCA 3456 Leu Leu Ile Leu Cys Phe Ile Lys Arg Ser Ly - #s Gly Gly Lys Tyr Ser 1140 - # 1145 - # 1150 - - GTG AAG GAT AAG GAG GAC ACC CAG GTG GAC TC - #T GAG GCC CGA CCG ATG 3504 Val Lys Asp Lys Glu Asp Thr Gln Val Asp Se - #r Glu Ala Arg Pro Met 1155 - # 1160 - # 1165 - - AAA GAT GAG ACC TTC GGC GAG TAC AGG TCC CT - #G GAG AGT GAC AAC GAG 3552 Lys Asp Glu Thr Phe Gly Glu Tyr Arg Ser Le - #u Glu Ser Asp Asn Glu 1170 - # 1175 - # 1180 - - GAG AAG GCC TTT GGC AGC AGC CAG CCA TCG CT - #C AAC GGG GAC ATC AAG 3600 Glu Lys Ala Phe Gly Ser Ser Gln Pro Ser Le - #u Asn Gly Asp Ile Lys 1185 1190 - # 1195 - # 1200 - - CCC CTG GGC AGT GAC GAC AGC CTG GCC GAT TA - #T GGG GGC AGC GTG GAT 3648 Pro Leu Gly Ser Asp Asp Ser Leu Ala Asp Ty - #r Gly Gly Ser Val Asp 1205 - # 1210 - # 1215 - - GTT CAG TTC AAC GAG GAT GGT TCG TTC ATT GG - #C CAG TAC AGT GGC AAG 3696 Val Gln Phe Asn Glu Asp Gly Ser Phe Ile Gl - #y Gln Tyr Ser Gly Lys 1220 - # 1225 - # 1230 - - AAG GAG AAG GAG GCG GCA GGG GGC AAT GAC AG - #C TCA GGG GCC ACT TCC 3744 Lys Glu Lys Glu Ala Ala Gly Gly Asn Asp Se - #r Ser Gly Ala Thr Ser 1235 - # 1240 - # 1245 - - CCC ATC AAC CCT GCC GTG GCC CTA GAA TAG - # - # 3774 Pro Ile Asn Pro Ala Val Ala Leu Glu 1250 - # 1255 - - - - (2) INFORMATION FOR SEQ ID NO:2: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 3774 (B) TYPE: nucleic acid (C) STRANDEDNESS: sing - #le (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: nucleic acids - - (iii) HYPOTHETICAL: irrelevant - - (iv) ANTI-SENSE: no - - (vi) ORIGINAL SOURCE: (A) ORGANISM: Homo Sapi - #ens (B) INDIVIDUAL ISOLATE: - #17-18 week fetus - - (vii) IMMEDIATE SOURCE: (A) LIBRARY: Stratagene - #cDNA Library 936206 (B) CLONE: synthesis of - # 4 clones - - (x) PUBLICATION INFORMATION: (A) AUTHORS: Hlavi - #n, Mary Louise Lemmon, V - #ance (B) TITLE: - #Molecular structure and functional testing of human L1C - #AM: an interspecies comparison. (C) JOURNAL: GENOM - #ICS (D) VOLUME: 11 (E) ISSUE: (F) PAGES: - #416-423 (G) DATE: - # 1991 (K) RELEVANT RESIDUES I - #N SEQ ID NO: 1 to 3774 - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO: - # 2: - - ATG GTC GTG GCG CTG CGG TAC GTG TGG CCT CT - #C CTC CTC TGC AGC CCC 48 Met Val Val Ala Leu Arg Tyr Val Trp Pro Le - #u Leu Leu Cys Ser Pro 1 5 - # 10 - # 15 - - TGC CTG CTT ATC CAG ATC CCC GAG GAA TAT GA - #A GGA CAC CAT GTG ATG 96 Cys Leu Leu Ile Gln Ile Pro Glu Glu Tyr Gl - #u Gly His His Val Met 20 - # 25 - # 30 - - GAG CCA CCT GTC ATC ACG GAA CAG TCT CCA CG - #G CGC CTG GTT GTC TTC 144 Glu Pro Pro Val Ile Thr Glu Gln Ser Pro Ar - #g Arg Leu Val Val Phe 35 - # 40 - # 45 - - CCC ACA GAT GAC ATC AGC CTC AAG TGT GAG GC - #C AGT GGC AAG CCC GAA 192 Pro Thr Asp Asp Ile Ser Leu Lys Cys Glu Al - #a Ser Gly Lys Pro Glu 50 - # 55 - # 60 - - GTG CAG TTC CGC TGG ACG AGG GAT GGT GTC CA - #C TTC AAA CCC AAG GAA 240 Val Gln Phe Arg Trp Thr Arg Asp Gly Val Hi - #s Phe Lys Pro Lys Glu 65 - # 70 - # 75 - # 80 - - GAG CTG GGT GTG ACC GTG TAC CAG TCG CCC CA - #C TCT GGC TCC TTC ACC 288 Glu Leu Gly Val Thr Val Tyr Gln Ser Pro Hi - #s Ser Gly Ser Phe Thr 85 - # 90 - # 95 - - ATC ACG GGC AAC AAC AGC AAC TTT GCT CAG AG - #G TTC CAG GGC ATC TAC 336 Ile Thr Gly Asn Asn Ser Asn Phe Ala Gln Ar - #g Phe Gln Gly Ile Tyr 100 - # 105 - # 110 - - CGC TGC TTT GCC AGC AAT AAG CTG GGC ACC GC - #C ATG TCC CAT GAG ATC 384 Arg Cys Phe Ala Ser Asn Lys Leu Gly Thr Al - #a Met Ser His Glu Ile 115 - # 120 - # 125 - - CGG CTC ATG GCC GAG GGT GCC CCC AAG TGG CC - #A AAG GAG ACA GTG AAG 432 Arg Leu Met Ala Glu Gly Ala Pro Lys Trp Pr - #o Lys Glu Thr Val Lys 130 - # 135 - # 140 - - CCC GTG GAG GTG GAG GAA GGG GAG TCA GTG GT - #T CTG CCT TGC AAC CCT 480 Pro Val Glu Val Glu Glu Gly Glu Ser Val Va - #l Leu Pro Cys Asn Pro 145 1 - #50 1 - #55 1 - #60 - - CCC CCA AGT GCA GAG CCT CTC CGG ATC TAC TG - #G ATG AAC AGC AAG ATC 528 Pro Pro Ser Ala Glu Pro Leu Arg Ile Tyr Tr - #p Met Asn Ser Lys Ile 165 - # 170 - # 175 - - TTG CAC ATC AAG CAG GAC GAG CGG GTG ACG AT - #G GGC CAG AAC GGC AAC 576 Leu His Ile Lys Gln Asp Glu Arg Val Thr Me - #t Gly Gln Asn Gly Asn 180 - # 185 - # 190 - - CTC TAC TTT GCC AAT GTG CTC ACC TCC GAC AA - #C CAC TCA GAC TAC ATC 624 Leu Tyr Phe Ala Asn Val Leu Thr Ser Asp As - #n His Ser Asp Tyr Ile 195 - # 200 - # 205 - - TGC CAC GCC CAC TTC CCA GGC ACC AGG ACC AT - #C ATT CAG AAG GAA CCC 672 Cys His Ala His Phe Pro Gly Thr Arg Thr Il - #e Ile Gln Lys Glu Pro 210 - # 215 - # 220 - - ATT GAC CTC CGG GTC AAG GCC ACC AAC AGC AT - #G ATT GAC AGG AAG CCG 720 Ile Asp Leu Arg Val Lys Ala Thr Asn Ser Me - #t Ile Asp Arg Lys Pro 225 2 - #30 2 - #35 2 - #40 - - CGC CTG CTC TTC CCC ACC AAC TCC AGC AGC CA - #C CTG GTG GCC TTG CAG 768 Arg Leu Leu Phe Pro Thr Asn Ser Ser Ser Hi - #s Leu Val Ala Leu Gln 245 - # 250 - # 255 - - GGG CAG CCA TTG GTC CTG GAG TGC ATC GCC GA - #G GGC TTT CCC ACG CCC 816 Gly Gln Pro Leu Val Leu Glu Cys Ile Ala Gl - #u Gly Phe Pro Thr Pro 260 - # 265 - # 270 - - ACC ATC AAA TGG CTG CGC CCC AGT GGC CCC AT - #G CCA GCT GAC CGT GTC 864 Thr Ile Lys Trp Leu Arg Pro Ser Gly Pro Me - #t Pro Ala Asp Arg Val 275 - # 280 - # 285 - - ACC TAC CAG AAC CAC AAC AAG ACC CTG CAG CT - #G CTG AAA GTG GGC GAG 912 Thr Tyr Gln Asn His Asn Lys Thr Leu Gln Le - #u Leu Lys Val Gly Glu 290 - # 295 - # 300 - - GAG GAT GAT GGC GAG TAC CGC TGC CTG GCC GA - #G AAC TCA CTG GGC AGT 960 Glu Asp Asp Gly Glu Tyr Arg Cys Leu Ala Gl - #u Asn Ser Leu Gly Ser 305 3 - #10 3 - #15 3 - #20 - - GCC CGG CAT GCG TAC TAT GTC ACC GTG GAG GC - #T GCC CCG TAC TGG CTG 1008 Ala Arg His Ala Tyr Tyr Val Thr Val Glu Al - #a Ala Pro Tyr Trp Leu 325 - # 330 - # 335 - - CAC AAG CCC CAG AGC CAT CTA TAT GGG CCA GG - #A GAG ACT GCC CGC CTG 1056 His Lys Pro Gln Ser His Leu Tyr Gly Pro Gl - #y Glu Thr Ala Arg Leu 340 - # 345 - # 350 - - GAC TGC CAA GTC CAG GGC AGG CCC CAA CCA GA - #G GTC ACC TGG AGA ATC 1104 Asp Cys Gln Val Gln Gly Arg Pro Gln Pro Gl - #u Val Thr Trp Arg Ile 355 - # 360 - # 365 - - AAC GGG ATC CCT GTG GAG GAG CTG GCC AAA GA - #C CAG AAG TAC CGG ATT 1152 Asn Gly Ile Pro Val Glu Glu Leu Ala Lys As - #p Gln Lys Tyr Arg Ile 370 - # 375 - # 380 - - CAG CGT GGC GCC CTG ATC CTG AGC AAC GTG CA - #G CCC AGT GAC ACA ATG 1200 Gln Arg Gly Ala Leu Ile Leu Ser Asn Val Gl - #n Pro Ser Asp Thr Met 385 3 - #90 3 - #95 4 - #00 - - GTG ACC CAA TGT GAG GCC CGC AAC CGG CAC GG - #G CTC TTG CTG GCC AAT 1248

Val Thr Gln Cys Glu Ala Arg Asn Arg His Gl - #y Leu Leu Leu Ala Asn 405 - # 410 - # 415 - - GCC TAC ATC TAC GTT GTC CAG CTG CCA GCC AA - #G ATC CTG ACT GCG GAC 1296 Ala Tyr Ile Tyr Val Val Gln Leu Pro Ala Ly - #s Ile Leu Thr Ala Asp 420 - # 425 - # 430 - - AAT CAG ACG TAC ATG GCT GTC CAG GGC AGC AC - #T GCC TAC CTT CTG TGC 1344 Asn Gln Thr Tyr Met Ala Val Gln Gly Ser Th - #r Ala Tyr Leu Leu Cys 435 - # 440 - # 445 - - AAG GCC TTC GGA GCG CCT GTG CCC AGT GTT CA - #G TGG CTG GAC GAG GAT 1392 Lys Ala Phe Gly Ala Pro Val Pro Ser Val Gl - #n Trp Leu Asp Glu Asp 450 - # 455 - # 460 - - GGG ACA ACA GTG CTT CAG GAC GAA CGC TTC TT - #C CCC TAT GCC AAT GGG 1440 Gly Thr Thr Val Leu Gln Asp Glu Arg Phe Ph - #e Pro Tyr Ala Asn Gly 465 4 - #70 4 - #75 4 - #80 - - ACC CTG GGC ATT CGA GAC CTC CAG GCC AAT GA - #C ACC GGA CGC TAC TTC 1488 Thr Leu Gly Ile Arg Asp Leu Gln Ala Asn As - #p Thr Gly Arg Tyr Phe 485 - # 490 - # 495 - - TGC CTG GCT GCC AAT GAC CAA AAC AAT GTT AC - #C ATC ATG GCT AAC CTG 1536 Cys Leu Ala Ala Asn Asp Gln Asn Asn Val Th - #r Ile Met Ala Asn Leu 500 - # 505 - # 510 - - AAG GTT AAA GAT GCA ACT CAG ATC ACT CAG GG - #G CCC CGC AGC ACA ATC 1584 Lys Val Lys Asp Ala Thr Gln Ile Thr Gln Gl - #y Pro Arg Ser Thr Ile 515 - # 520 - # 525 - - GAG AAG AAA GGT TCC AGG GTG ACC TTC ACG TG - #C CAG GCC TCC TTT GAC 1632 Glu Lys Lys Gly Ser Arg Val Thr Phe Thr Cy - #s Gln Ala Ser Phe Asp 530 - # 535 - # 540 - - CCC TCC TTG CAG CCC AGC ATC ACC TGG CGT GG - #G GAC GGT CGA GAC CTC 1680 Pro Ser Leu Gln Pro Ser Ile Thr Trp Arg Gl - #y Asp Gly Arg Asp Leu 545 5 - #50 5 - #55 5 - #60 - - CAG GAG CTT GGG GAC AGT GAC AAG TAC TTC AT - #A GAG GAT GGG CGC CTG 1728 Gln Glu Leu Gly Asp Ser Asp Lys Tyr Phe Il - #e Glu Asp Gly Arg Leu 565 - # 570 - # 575 - - GTC ATC CAC AGC CTG GAC TAC AGC GAC CAG GG - #C AAC TAC AGC TGC GTG 1776 Val Ile His Ser Leu Asp Tyr Ser Asp Gln Gl - #y Asn Tyr Ser Cys Val 580 - # 585 - # 590 - - GCC AGT ACC GAA CTG GAT GTG GTG GAG AGT AG - #G GCA CAG CTC TTG GTG 1824 Ala Ser Thr Glu Leu Asp Val Val Glu Ser Ar - #g Ala Gln Leu Leu Val 595 - # 600 - # 605 - - GTG GGG AGC CCT GGG CCG GTG CCA CGG CTG GT - #G CTG TCC GAC CTG CAC 1872 Val Gly Ser Pro Gly Pro Val Pro Arg Leu Va - #l Leu Ser Asp Leu His 610 - # 615 - # 620 - - CTG CTG ACG CAG AGC CAG GTG CGC GTG TCC TG - #G AGT CCT GCA GAA GAC 1920 Leu Leu Thr Gln Ser Gln Val Arg Val Ser Tr - #p Ser Pro Ala Glu Asp 625 6 - #30 6 - #35 6 - #40 - - CAC AAT GCC CCC ATT GAG AAA TAT GAC ATT GA - #A TTT GAG GAC AAG GAA 1968 His Asn Ala Pro Ile Glu Lys Tyr Asp Ile Gl - #u Phe Glu Asp Lys Glu 645 - # 650 - # 655 - - ATG GCG CCT GAA AAA TGG TAC AGT CTG GGC AA - #G GTT CCA GGG AAC CAG 2016 Met Ala Pro Glu Lys Trp Tyr Ser Leu Gly Ly - #s Val Pro Gly Asn Gln 660 - # 665 - # 670 - - ACC TCT ACC ACC CTC AAG CTG TCG CCC TAT GT - #C CAC TAC ACC TTT AGG 2064 Thr Ser Thr Thr Leu Lys Leu Ser Pro Tyr Va - #l His Tyr Thr Phe Arg 675 - # 680 - # 685 - - GTT ACT GCC ATA AAC AAA TAT GGC CCC GGG GA - #G CCC AGC CCG GTC TCT 2112 Val Thr Ala Ile Asn Lys Tyr Gly Pro Gly Gl - #u Pro Ser Pro Val Ser 690 - # 695 - # 700 - - GAG ACT GTG GTC ACA CCT GAG GCA GCC CCA GA - #G AAG AAC CCT GTG GAT 2160 Glu Thr Val Val Thr Pro Glu Ala Ala Pro Gl - #u Lys Asn Pro Val Asp 705 7 - #10 7 - #15 7 - #20 - - GTG AAG GGG GAA GGA AAT GAG ACC ACC AAT AT - #G GTC ATC ACG TGG AAG 2208 Val Lys Gly Glu Gly Asn Glu Thr Thr Asn Me - #t Val Ile Thr Trp Lys 725 - # 730 - # 735 - - CCG CTC CGG TGG ATG GAC TGG AAC GCC CCC CA - #G GTT CAG TAC CGC GTG 2256 Pro Leu Arg Trp Met Asp Trp Asn Ala Pro Gl - #n Val Gln Tyr Arg Val 740 - # 745 - # 750 - - CAG TGG CGC CCT CAG GGG ACA CGA GGG CCC TG - #G CAG GAG CAG ATT GTC 2304 Gln Trp Arg Pro Gln Gly Thr Arg Gly Pro Tr - #p Gln Glu Gln Ile Val 755 - # 760 - # 765 - - AGC GAC CCC TTC CTG GTG GTG TCC AAC ACG TC - #C ACC TTC GTG CCC TAT 2352 Ser Asp Pro Phe Leu Val Val Ser Asn Thr Se - #r Thr Phe Val Pro Tyr 770 - # 775 - # 780 - - GAG ATC AAA GTC CAG GCC GTC AAC AGC CAG GG - #C AAG GGA CCA GAG CCC 2400 Glu Ile Lys Val Gln Ala Val Asn Ser Gln Gl - #y Lys Gly Pro Glu Pro 785 7 - #90 7 - #95 8 - #00 - - CAG GTC ACT ATC GGC TAC TCT GGA GAG GAC TA - #C CCC CAG GCA ATC CCT 2448 Gln Val Thr Ile Gly Tyr Ser Gly Glu Asp Ty - #r Pro Gln Ala Ile Pro 805 - # 810 - # 815 - - GAG CTG GAA GGC ATT GAA ATC CTC AAC TCA AG - #T GCC GTG CTG GTC AAG 2496 Glu Leu Glu Gly Ile Glu Ile Leu Asn Ser Se - #r Ala Val Leu Val Lys 820 - # 825 - # 830 - - TGG CGG CCG GTG GAC CTG GCC CAG GTC AAG GG - #C CAC CTC CGC GGA TAC 2544 Trp Arg Pro Val Asp Leu Ala Gln Val Lys Gl - #y His Leu Arg Gly Tyr 835 - # 840 - # 845 - - AAT GTG ACG TAC TGG AGG GAG GGC AGT CAG AG - #G AAG CAC AGC AAG AGA 2592 Asn Val Thr Tyr Trp Arg Glu Gly Ser Gln Ar - #g Lys His Ser Lys Arg 850 - # 855 - # 860 - - CAT ATC CAC AAA GAC CAT GTG GTG GTG CCC GC - #C AAC ACC ACC AGT GTC 2640 His Ile His Lys Asp His Val Val Val Pro Al - #a Asn Thr Thr Ser Val 865 8 - #70 8 - #75 8 - #80 - - ATC CTC AGT GGC TTG CGG CCC TAT AGC TCC TA - #C CAC CTG GAG GTG CAG 2688 Ile Leu Ser Gly Leu Arg Pro Tyr Ser Ser Ty - #r His Leu Glu Val Gln 885 - # 890 - # 895 - - GCC TTT AAC GGG CGA GGA TCG GGG CCC GCC AG - #C GAG TTC ACC TTC AGC 2736 Ala Phe Asn Gly Arg Gly Ser Gly Pro Ala Se - #r Glu Phe Thr Phe Ser 900 - # 905 - # 910 - - ACC CCA GAG GGA GTG CCT GGC CAC CCC GAG GC - #G TTG CAC CTG GAG TGC 2784 Thr Pro Glu Gly Val Pro Gly His Pro Glu Al - #a Leu His Leu Glu Cys 915 - # 920 - # 925 - - CAG TCG AAC ACC AGC CTG CTG CTG CGC TGG CA - #G CCC CCA CTC AGC CAC 2832 Gln Ser Asn Thr Ser Leu Leu Leu Arg Trp Gl - #n Pro Pro Leu Ser His 930 - # 935 - # 940 - - AAC GGC GTG CTC ACC GGC TAC GTG CTC TCC TA - #C CAC CCC CTG GAT GAG 2880 Asn Gly Val Leu Thr Gly Tyr Val Leu Ser Ty - #r His Pro Leu Asp Glu 945 9 - #50 9 - #55 9 - #60 - - GGG GGC AAG GGG CAA CTG TCC TTC AAC CTT CG - #G GAC CCC GAA CTT CGG 2928 Gly Gly Lys Gly Gln Leu Ser Phe Asn Leu Ar - #g Asp Pro Glu Leu Arg 965 - # 970 - # 975 - - ACA CAC AAC CTG ACC GAT CTC AGC CCC CAC CT - #G CGG TAC CGC TTC CAG 2976 Thr His Asn Leu Thr Asp Leu Ser Pro His Le - #u Arg Tyr Arg Phe Gln 980 - # 985 - # 990 - - CTT CAG GCC ACC ACC AAA GAG GGC CCT GGT GA - #A GCC ATC GTA CGG GAA 3024 Leu Gln Ala Thr Thr Lys Glu Gly Pro Gly Gl - #u Ala Ile Val Arg Glu 995 - # 1000 - # 1005 - - GGA GGC ACT ATG GCC TTG TCT GGG ATC TCA GA - #T TTT GGC AAC ATC TCA 3072 Gly Gly Thr Met Ala Leu Ser Gly Ile Ser As - #p Phe Gly Asn Ile Ser 1010 - # 1015 - # 1020 - - GCC ACA GCG GGT GAA AAC TAC AGT GTC GTC TC - #C TGG GTC CCC AAG GAG 3120 Ala Thr Ala Gly Glu Asn Tyr Ser Val Val Se - #r Trp Val Pro Lys Glu 1025 1030 - # 1035 - # 1040 - - GGC CAG TGC AAC TTC AGG TTC CAT ATC TTG TT - #C AAA GCC TTG GGA GAA 3168 Gly Gln Cys Asn Phe Arg Phe His Ile Leu Ph - #e Lys Ala Leu Gly Glu 1045 - # 1050 - # 1055 - - GAG AAG GGT GGG GCT TCC CTT TCG CCA CAG TA - #T GTC AGC TAC AAC CAG 3216 Glu Lys Gly Gly Ala Ser Leu Ser Pro Gln Ty - #r Val Ser Tyr Asn Gln 1060 - # 1065 - # 1070 - - AGC TCC TAC ACG CAG TGG GAC CTG CAG CCT GA - #C ACT GAC TAC GAG ATC 3264 Ser Ser Tyr Thr Gln Trp Asp Leu Gln Pro As - #p Thr Asp Tyr Glu Ile 1075 - # 1080 - # 1085 - - CAC TTG TTT AAG GAG AGG ATG TTC CGG CAC CA - #A ATG GCT GTG AAG ACC 3312 His Leu Phe Lys Glu Arg Met Phe Arg His Gl - #n Met Ala Val Lys Thr 1090 - # 1095 - # 1100 - - AAT GGC ACA GGC CGC GTG AGG CTC CCT CCT GC - #T GGC TTC GCC ACT GAG 3360 Asn Gly Thr Gly Arg Val Arg Leu Pro Pro Al - #a Gly Phe Ala Thr Glu 1105 1110 - # 1115 - # 1120 - - GGC TGG TTC ATC GGC TTT GTG AGT GCC ATC AT - #C CTC CTG CTC CTC GTC 3408 Gly Trp Phe Ile Gly Phe Val Ser Ala Ile Il - #e Leu Leu Leu Leu Val 1125 - # 1130 - # 1135 - - CTG CTC ATC CTC TGC TTC ATC AAG CGC AGC AA - #G GGC GGC AAA TAC TCA 3456 Leu Leu Ile Leu Cys Phe Ile Lys Arg Ser Ly - #s Gly Gly Lys Tyr Ser 1140 - # 1145 - # 1150 - - GTG AAG GAT AAG GAG GAC ACC CAG GTG GAC TC - #T GAG GCC CGA CCG ATG 3504 Val Lys Asp Lys Glu Asp Thr Gln Val Asp Se - #r Glu Ala Arg Pro Met 1155 - # 1160 - # 1165 - - AAA GAT GAG ACC TTC GGC GAG TAC AGG TCC CT - #G GAG AGT GAC AAC GAG 3552 Lys Asp Glu Thr Phe Gly Glu Tyr Arg Ser Le - #u Glu Ser Asp Asn Glu 1170 - # 1175 - # 1180 - - GAG AAG GCC TTT GGC AGC AGC CAG CCA TCG CT - #C AAC GGG GAC ATC AAG 3600 Glu Lys Ala Phe Gly Ser Ser Gln Pro Ser Le - #u Asn Gly Asp Ile Lys 1185 1190 - # 1195 - # 1200 - - CCC CTG GGC AGT GAC GAC AGC CTG GCC GAT TA - #T GGG GGC AGC GTG GAT 3648 Pro Leu Gly Ser Asp Asp Ser Leu Ala Asp Ty - #r Gly Gly Ser Val Asp 1205 - # 1210 - # 1215 - - GTT CAG TTC AAC GAG GAT GGT TCG TTC ATT GG - #C CAG TAC AGT GGC AAG 3696 Val Gln Phe Asn Glu Asp Gly Ser Phe Ile Gl - #y Gln Tyr Ser Gly Lys 1220 - # 1225 - # 1230 - - AAG GAG AAG GAG GCG GCA GGG GGC AAT GAC AG - #C TCA GGG GCC ACT TCC 3744 Lys Glu Lys Glu Ala Ala Gly Gly Asn Asp Se - #r Ser Gly Ala Thr Ser 1235 - # 1240 - # 1245 - - CCC ATC AAC CCT GCC GTG GCC CTA GAA TAG - # - # 3774 Pro Ile Asn Pro Ala Val Ala Leu Glu stop 1250 - # 1255 - - (2) INFORMATION FOR SEQ ID NO:3: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 3189 (B) TYPE: nucleic acid (C) STRANDEDNESS: sing - #le (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: nucleic acids - - (iii) HYPOTHETICAL: irrelevant - - (iv) ANTI-SENSE: no - - (vi) ORIGINAL SOURCE: (A) ORGANISM: homo sapi - #ens (B) INDIVIDUAL ISOLATE: - #17-18 week fetus - - (vii) IMMEDIATE SOURCE: (A) LIBRARY: Stratagene - #cDNA Library 936206 (B) CLONE: 3.1 - - (x) PUBLICATION INFORMATION: (A) AUTHORS: Hlavi - #n, Mary Louise Lemmon, V - #ance (B) TITLE: - #Molecular structure and functional testing of human L1C - #AM: an interspecies comparison. (C) JOURNAL: GENOM - #ICS (D) VOLUME: 11 (E) ISSUE: (F) PAGES: - #416-423 (G) DATE: - # 1991 (K) RELEVANT RESIDUES I - #N SEQ ID NO: 548 to 3736 - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO: - # 3: - - AG CGG GTG ACG ATG GGC CAG AAC GGC AAC CTC - # TAC TTT GCC AAT GTG 47

Arg Val Thr Met Gly Gln Asn Gly Asn - #Leu Tyr Phe Ala Asn Val 1 - # 5 - # 10 - # 15 - - CTC ACC TCC GAC AAC CAC TCA GAC TAC ATC TG - #C CAC GCC CAC TTC CCA 95 Leu Thr Ser Asp Asn His Ser Asp Tyr Ile Cy - #s His Ala His Phe Pro 20 - # 25 - # 30 - - GGC ACC AGG ACC ATC ATT CAG AAG GAA CCC AT - #T GAC CTC CGG GTC AAG 143 Gly Thr Arg Thr Ile Ile Gln Lys Glu Pro Il - #e Asp Leu Arg Val Lys 35 - # 40 - # 45 - - GCC ACC AAC AGC ATG ATT GAC AGG AAG CCG CG - #C CTG CTC TTC CCC ACC 191 Ala Thr Asn Ser Met Ile Asp Arg Lys Pro Ar - #g Leu Leu Phe Pro Thr 50 - # 55 - # 60 - - AAC TCC AGC AGC CAC CTG GTG GCC TTG CAG GG - #G CAG CCA TTG GTC CTG 239 Asn Ser Ser Ser His Leu Val Ala Leu Gln Gl - #y Gln Pro Leu Val Leu 65 - # 70 - # 75 - - GAG TGC ATC GCC GAG GGC TTT CCC ACG CCC AC - #C ATC AAA TGG CTG CGC 287 Glu Cys Ile Ala Glu Gly Phe Pro Thr Pro Th - #r Ile Lys Trp Leu Arg 80 - # 85 - # 90 - # 95 - - CCC AGT GGC CCC ATG CCA GCT GAC CGT GTC AC - #C TAC CAG AAC CAC AAC 335 Pro Ser Gly Pro Met Pro Ala Asp Arg Val Th - #r Tyr Gln Asn His Asn 100 - # 105 - # 110 - - AAG ACC CTG CAG CTG CTG AAA GTG GGC GAG GA - #G GAT GAT GGC GAG TAC 383 Lys Thr Leu Gln Leu Leu Lys Val Gly Glu Gl - #u Asp Asp Gly Glu Tyr 115 - # 120 - # 125 - - CGC TGC CTG GCC GAG AAC TCA CTG GGC AGT GC - #C CGG CAT GCG TAC TAT 431 Arg Cys Leu Ala Glu Asn Ser Leu Gly Ser Al - #a Arg His Ala Tyr Tyr 130 - # 135 - # 140 - - GTC ACC GTG GAG GCT GCC CCG TAC TGG CTG CA - #C AAG CCC CAG AGC CAT 479 Val Thr Val Glu Ala Ala Pro Tyr Trp Leu Hi - #s Lys Pro Gln Ser His 145 - # 150 - # 155 - - CTA TAT GGG CCA GGA GAG ACT GCC CGC CTG GA - #C TGC CAA GTC CAG GGC 527 Leu Tyr Gly Pro Gly Glu Thr Ala Arg Leu As - #p Cys Gln Val Gln Gly 160 1 - #65 1 - #70 1 - #75 - - AGG CCC CAA CCA GAG GTC ACC TGG AGA ATC AA - #C GGG ATC CCT GTG GAG 575 Arg Pro Gln Pro Glu Val Thr Trp Arg Ile As - #n Gly Ile Pro Val Glu 180 - # 185 - # 190 - - GAG CTG GCC AAA GAC CAG AAG TAC CGG ATT CA - #G CGT GGC GCC CTG ATC 623 Glu Leu Ala Lys Asp Gln Lys Tyr Arg Ile Gl - #n Arg Gly Ala Leu Ile 195 - # 200 - # 205 - - CTG AGC AAC GTG CAG CCC AGT GAC ACA ATG GT - #G ACC CAA TGT GAG GCC 671 Leu Ser Asn Val Gln Pro Ser Asp Thr Met Va - #l Thr Gln Cys Glu Ala 210 - # 215 - # 220 - - CGC AAC CGG CAC GGG CTC TTG CTG GCC AAT GC - #C TAC ATC TAC GTT GTC 719 Arg Asn Arg His Gly Leu Leu Leu Ala Asn Al - #a Tyr Ile Tyr Val Val 225 - # 230 - # 235 - - CAG CTG CCA GCC AAG ATC CTG ACT GCG GAC AA - #T CAG ACG TAC ATG GCT 767 Gln Leu Pro Ala Lys Ile Leu Thr Ala Asp As - #n Gln Thr Tyr Met Ala 240 2 - #45 2 - #50 2 - #55 - - GTC CAG GGC AGC ACT GCC TAC CTT CTG TGC AA - #G GCC TTC GGA GCG CCT 815 Val Gln Gly Ser Thr Ala Tyr Leu Leu Cys Ly - #s Ala Phe Gly Ala Pro 260 - # 265 - # 270 - - GTG CCC AGT GTT CAG TGG CTG GAC GAG GAT GG - #G ACA ACA GTG CTT CAG 863 Val Pro Ser Val Gln Trp Leu Asp Glu Asp Gl - #y Thr Thr Val Leu Gln 275 - # 280 - # 285 - - GAC GAA CGC TTC TTC CCC TAT GCC AAT GGG AC - #C CTG GGC ATT CGA GAC 911 Asp Glu Arg Phe Phe Pro Tyr Ala Asn Gly Th - #r Leu Gly Ile Arg Asp 290 - # 295 - # 300 - - CTC CAG GCC AAT GAC ACC GGA CGC TAC TTC TG - #C CTG GCT GCC AAT GAC 959 Leu Gln Ala Asn Asp Thr Gly Arg Tyr Phe Cy - #s Leu Ala Ala Asn Asp 305 - # 310 - # 315 - - CAA AAC AAT GTT ACC ATC ATG GCT AAC CTG AA - #G GTT AAA GAT GCA ACT 1007 Gln Asn Asn Val Thr Ile Met Ala Asn Leu Ly - #s Val Lys Asp Ala Thr 320 3 - #25 3 - #30 3 - #35 - - CAG ATC ACT CAG GGG CCC CGC AGC ACA ATC GA - #G AAG AAA GGT TCC AGG 1055 Gln Ile Thr Gln Gly Pro Arg Ser Thr Ile Gl - #u Lys Lys Gly Ser Arg 340 - # 345 - # 350 - - GTG ACC TTC ACG TGC CAG GCC TCC TTT GAC CC - #C TCC TTG CAG CCC AGC 1103 Val Thr Phe Thr Cys Gln Ala Ser Phe Asp Pr - #o Ser Leu Gln Pro Ser 355 - # 360 - # 365 - - ATC ACC TGG CGT GGG GAC GGT CGA GAC CTC CA - #G GAG CTT GGG GAC AGT 1151 Ile Thr Trp Arg Gly Asp Gly Arg Asp Leu Gl - #n Glu Leu Gly Asp Ser 370 - # 375 - # 380 - - GAC AAG TAC TTC ATA GAG GAT GGG CGC CTG GT - #C ATC CAC AGC CTG GAC 1199 Asp Lys Tyr Phe Ile Glu Asp Gly Arg Leu Va - #l Ile His Ser Leu Asp 385 - # 390 - # 395 - - TAC AGC GAC CAG GGC AAC TAC AGC TGC GTG GC - #C AGT ACC GAA CTG GAT 1247 Tyr Ser Asp Gln Gly Asn Tyr Ser Cys Val Al - #a Ser Thr Glu Leu Asp 400 4 - #05 4 - #10 4 - #15 - - GTG GTG GAG AGT AGG GCA CAG CTC TTG GTG GT - #G GGG AGC CCT GGG CCG 1295 Val Val Glu Ser Arg Ala Gln Leu Leu Val Va - #l Gly Ser Pro Gly Pro 420 - # 425 - # 430 - - GTG CCA CGG CTG GTG CTG TCC GAC CTG CAC CT - #G CTG ACG CAG AGC CAG 1343 Val Pro Arg Leu Val Leu Ser Asp Leu His Le - #u Leu Thr Gln Ser Gln 435 - # 440 - # 445 - - GTG CGC GTG TCC TGG AGT CCT GCA GAA GAC CA - #C AAT GCC CCC ATT GAG 1391 Val Arg Val Ser Trp Ser Pro Ala Glu Asp Hi - #s Asn Ala Pro Ile Glu 450 - # 455 - # 460 - - AAA TAT GAC ATT GAA TTT GAG GAC AAG GAA AT - #G GCG CCT GAA AAA TGG 1439 Lys Tyr Asp Ile Glu Phe Glu Asp Lys Glu Me - #t Ala Pro Glu Lys Trp 465 - # 470 - # 475 - - TAC AGT CTG GGC AAG GTT CCA GGG AAC CAG AC - #C TCT ACC ACC CTC AAG 1487 Tyr Ser Leu Gly Lys Val Pro Gly Asn Gln Th - #r Ser Thr Thr Leu Lys 480 4 - #85 4 - #90 4 - #95 - - CTG TCG CCC TAT GTC CAC TAC ACC TTT AGG GT - #T ACT GCC ATA AAC AAA 1535 Leu Ser Pro Tyr Val His Tyr Thr Phe Arg Va - #l Thr Ala Ile Asn Lys 500 - # 505 - # 510 - - TAT GGC CCC GGG GAG CCC AGC CCG GTC TCT GA - #G ACT GTG GTC ACA CCT 1583 Tyr Gly Pro Gly Glu Pro Ser Pro Val Ser Gl - #u Thr Val Val Thr Pro 515 - # 520 - # 525 - - GAG GCA GCC CCA GAG AAG AAC CCT GTG GAT GT - #G AAG GGG GAA GGA AAT 1631 Glu Ala Ala Pro Glu Lys Asn Pro Val Asp Va - #l Lys Gly Glu Gly Asn 530 - # 535 - # 540 - - GAG ACC ACC AAT ATG GTC ATC ACG TGG AAG CC - #G CTC CGG TGG ATG GAC 1679 Glu Thr Thr Asn Met Val Ile Thr Trp Lys Pr - #o Leu Arg Trp Met Asp 545 - # 550 - # 555 - - TGG AAC GCC CCC CAG GTT CAG TAC CGC GTG CA - #G TGG CGC CCT CAG GGG 1727 Trp Asn Ala Pro Gln Val Gln Tyr Arg Val Gl - #n Trp Arg Pro Gln Gly 560 5 - #65 5 - #70 5 - #75 - - ACA CGA GGG CCC TGG CAG GAG CAG ATT GTC AG - #C GAC CCC TTC CTG GTG 1775 Thr Arg Gly Pro Trp Gln Glu Gln Ile Val Se - #r Asp Pro Phe Leu Val 580 - # 585 - # 590 - - GTG TCC AAC ACG TCC ACC TTC GTG CCC TAT GA - #G ATC AAA GTC CAG GCC 1823 Val Ser Asn Thr Ser Thr Phe Val Pro Tyr Gl - #u Ile Lys Val Gln Ala 595 - # 600 - # 605 - - GTC AAC AGC CAG GGC AAG GGA CCA GAG CCC CA - #G GTC ACT ATC GGC TAC 1871 Val Asn Ser Gln Gly Lys Gly Pro Glu Pro Gl - #n Val Thr Ile Gly Tyr 610 - # 615 - # 620 - - TCT GGA GAG GAC TAC CCC CAG GCA ATC CCT GA - #G CTG GAA GGC ATT GAA 1919 Ser Gly Glu Asp Tyr Pro Gln Ala Ile Pro Gl - #u Leu Glu Gly Ile Glu 625 - # 630 - # 635 - - ATC CTC AAC TCA AGT GCC GTG CTG GTC AAG TG - #G CGG CCG GTG GAC CTG 1967 Ile Leu Asn Ser Ser Ala Val Leu Val Lys Tr - #p Arg Pro Val Asp Leu 640 6 - #45 6 - #50 6 - #55 - - GCC CAG GTC AAG GGC CAC CTC CGC GGA TAC AA - #T GTG ACG TAC TGG AGG 2015 Ala Gln Val Lys Gly His Leu Arg Gly Tyr As - #n Val Thr Tyr Trp Arg 660 - # 665 - # 670 - - GAG GGC AGT CAG AGG AAG CAC AGC AAG AGA CA - #T ATC CAC AAA GAC CAT 2063 Glu Gly Ser Gln Arg Lys His Ser Lys Arg Hi - #s Ile His Lys Asp His 675 - # 680 - # 685 - - GTG GTG GTG CCC GCC AAC ACC ACC AGT GTC AT - #C CTC AGT GGC TTG CGG 2111 Val Val Val Pro Ala Asn Thr Thr Ser Val Il - #e Leu Ser Gly Leu Arg 690 - # 695 - # 700 - - CCC TAT AGC TCC TAC CAC CTG GAG GTG CAG GC - #C TTT AAC GGG CGA GGA 2159 Pro Tyr Ser Ser Tyr His Leu Glu Val Gln Al - #a Phe Asn Gly Arg Gly 705 - # 710 - # 715 - - TCG GGG CCC GCC AGC GAG TTC ACC TTC AGC AC - #C CCA GAG GGA GTG CCT 2207 Ser Gly Pro Ala Ser Glu Phe Thr Phe Ser Th - #r Pro Glu Gly Val Pro 720 7 - #25 7 - #30 7 - #35 - - GGC CAC CCC GAG GCG TTG CAC CTG GAG TGC CA - #G TCG AAC ACC AGC CTG 2255 Gly His Pro Glu Ala Leu His Leu Glu Cys Gl - #n Ser Asn Thr Ser Leu 740 - # 745 - # 750 - - CTG CTG CGC TGG CAG CCC CCA CTC AGC CAC AA - #C GGC GTG CTC ACC GGC 2303 Leu Leu Arg Trp Gln Pro Pro Leu Ser His As - #n Gly Val Leu Thr Gly 755 - # 760 - # 765 - - TAC GTG CTC TCC TAC CAC CCC CTG GAT GAG GG - #G GGC AAG GGG CAA CTG 2351 Tyr Val Leu Ser Tyr His Pro Leu Asp Glu Gl - #y Gly Lys Gly Gln Leu 770 - # 775 - # 780 - - TCC TTC AAC CTT CGG GAC CCC GAA CTT CGG AC - #A CAC AAC CTG ACC GAT 2399 Ser Phe Asn Leu Arg Asp Pro Glu Leu Arg Th - #r His Asn Leu Thr Asp 785 - # 790 - # 795 - - CTC AGC CCC CAC CTG CGG TAC CGC TTC CAG CT - #T CAG GCC ACC ACC AAA 2447 Leu Ser Pro His Leu Arg Tyr Arg Phe Gln Le - #u Gln Ala Thr Thr Lys 800 8 - #05 8 - #10 8 - #15 - - GAG GGC CCT GGT GAA GCC ATC GTA CGG GAA GG - #A GGC ACT ATG GCC TTG 2495 Glu Gly Pro Gly Glu Ala Ile Val Arg Glu Gl - #y Gly Thr Met Ala Leu 820 - # 825 - # 830 - - TCT GGG ATC TCA GAT TTT GGC AAC ATC TCA GC - #C ACA GCG GGT GAA AAC 2543 Ser Gly Ile Ser Asp Phe Gly Asn Ile Ser Al - #a Thr Ala Gly Glu Asn 835 - # 840 - # 845 - - TAC AGT GTC GTC TCC TGG GTC CCC AAG GAG GG - #C CAG TGC AAC TTC AGG 2591 Tyr Ser Val Val Ser Trp Val Pro Lys Glu Gl - #y Gln Cys Asn Phe Arg 850 - # 855 - # 860 - - TTC CAT ATC TTG TTC AAA GCC TTG GGA GAA GA - #G AAG GGT GGG GCT TCC 2639 Phe His Ile Leu Phe Lys Ala Leu Gly Glu Gl - #u Lys Gly Gly Ala Ser 865 - # 870 - # 875 - - CTT TCG CCA CAG TAT GTC AGC TAC AAC CAG AG - #C TCC TAC ACG CAG TGG 2687 Leu Ser Pro Gln Tyr Val Ser Tyr Asn Gln Se - #r Ser Tyr Thr Gln Trp 880 8 - #85 8 - #90 8 - #95 - - GAC CTG CAG CCT GAC ACT GAC TAC GAG ATC CA - #C TTG TTT AAG GAG AGG 2735 Asp Leu Gln Pro Asp Thr Asp Tyr Glu Ile Hi - #s Leu Phe Lys Glu Arg 900 - # 905 - # 910 - - ATG TTC CGG CAC CAA ATG GCT GTG AAG ACC AA - #T GGC ACA GGC CGC GTG 2783 Met Phe Arg His Gln Met Ala Val Lys Thr As - #n Gly Thr Gly Arg Val 915 - # 920 - # 925 - - AGG CTC CCT CCT GCT GGC TTC GCC ACT GAG GG - #C TGG TTC ATC GGC TTT 2831 Arg Leu Pro Pro Ala Gly Phe Ala Thr Glu Gl - #y Trp Phe Ile Gly Phe

930 - # 935 - # 940 - - GTG AGT GCC ATC ATC CTC CTG CTC CTC GTC CT - #G CTC ATC CTC TGC TTC 2879 Val Ser Ala Ile Ile Leu Leu Leu Leu Val Le - #u Leu Ile Leu Cys Phe 945 - # 950 - # 955 - - ATC AAG CGC AGC AAG GGC GGC AAA TAC TCA GT - #G AAG GAT AAG GAG GAC 2927 Ile Lys Arg Ser Lys Gly Gly Lys Tyr Ser Va - #l Lys Asp Lys Glu Asp 960 9 - #65 9 - #70 9 - #75 - - ACC CAG GTG GAC TCT GAG GCC CGA CCG ATG AA - #A GAT GAG ACC TTC GGC 2975 Thr Gln Val Asp Ser Glu Ala Arg Pro Met Ly - #s Asp Glu Thr Phe Gly 980 - # 985 - # 990 - - GAG TAC AGG TCC CTG GAG AGT GAC AAC GAG GA - #G AAG GCC TTT GGC AGC 3023 Glu Tyr Arg Ser Leu Glu Ser Asp Asn Glu Gl - #u Lys Ala Phe Gly Ser 995 - # 1000 - # 1005 - - AGC CAG CCA TCG CTC AAC GGG GAC ATC AAG CC - #C CTG GGC AGT GAC GAC 3071 Ser Gln Pro Ser Leu Asn Gly Asp Ile Lys Pr - #o Leu Gly Ser Asp Asp 1010 - # 1015 - # 1020 - - AGC CTG GCC GAT TAT GGG GGC AGC GTG GAT GT - #T CAG TTC AAC GAG GAT 3119 Ser Leu Ala Asp Tyr Gly Gly Ser Val Asp Va - #l Gln Phe Asn Glu Asp 1025 - # 1030 - # 1035 - - GGT TCG TTC ATT GGC CAG TAC AGT GGC AAG AA - #G GAG AAG GAG GCG GCA 3167 Gly Ser Phe Ile Gly Gln Tyr Ser Gly Lys Ly - #s Glu Lys Glu Ala Ala 1040 1045 - # 1050 - # 1055 - - GGG GGC AAT GAC AGC TCA GGG G - # - # 3189 Gly Gly Asn Asp Ser Ser Gly 1060 - - (2) INFORMATION FOR SEQ ID NO:4: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 2600 (B) TYPE: nucleic acid (C) STRANDEDNESS: sing - #le (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: nucleic acids - - (iii) HYPOTHETICAL: irrelevant - - (iv) ANTI-SENSE: no - - (vi) ORIGINAL SOURCE: (A) ORGANISM: homo sapi - #ens (B) INDIVIDUAL ISOLATE: - #17-18 week fetus - - (vii) IMMEDIATE SOURCE: (A) LIBRARY: Stratagene - #cDNA Library 936206 (B) CLONE: 4 - - (x) PUBLICATION INFORMATION: (A) AUTHORS: Hlavi - #n, Mary Louise Lemmon, V - #ance (B) TITLE: - #Molecular structure and functional testing of human L1C - #AM: an interspecies comparison. (C) JOURNAL: GENOM - #ICS (D) VOLUME: 11 (E) ISSUE: (F) PAGES: - #416-423 (G) DATE: - # 1991 (K) RELEVANT RESIDUES I - #N SEQ ID NO: 1108 to 3708 - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO: - # 4: - - GGG ATC CCT GTG GAG GAG CTG GCC AAA GAC CA - #G AAG TAC CGG ATT CAG 48 Gly Ile Pro Val Glu Glu Leu Ala Lys Asp Gl - #n Lys Tyr Arg Ile Gln 1 5 - # 10 - # 15 - - CGT GGC GCC CTG ATC CTG AGC AAC GTG CAG CC - #C AGT GAC ACA ATG GTG 96 Arg Gly Ala Leu Ile Leu Ser Asn Val Gln Pr - #o Ser Asp Thr Met Val 20 - # 25 - # 30 - - ACC CAA TGT GAG GCC CGC AAC CGG CAC GGG CT - #C TTG CTG GCC AAT GCC 144 Thr Gln Cys Glu Ala Arg Asn Arg His Gly Le - #u Leu Leu Ala Asn Ala 35 - # 40 - # 45 - - TAC ATC TAC GTT GTC CAG CTG CCA GCC AAG AT - #C CTG ACT GCG GAC AAT 192 Tyr Ile Tyr Val Val Gln Leu Pro Ala Lys Il - #e Leu Thr Ala Asp Asn 50 - # 55 - # 60 - - CAG ACG TAC ATG GCT GTC CAG GGC AGC ACT GC - #C TAC CTT CTG TGC AAG 240 Gln Thr Tyr Met Ala Val Gln Gly Ser Thr Al - #a Tyr Leu Leu Cys Lys 65 - # 70 - # 75 - # 80 - - GCC TTC GGA GCG CCT GTG CCC AGT GTT CAG TG - #G CTG GAC GAG GAT GGG 288 Ala Phe Gly Ala Pro Val Pro Ser Val Gln Tr - #p Leu Asp Glu Asp Gly 85 - # 90 - # 95 - - ACA ACA GTG CTT CAG GAC GAA CGC TTC TTC CC - #C TAT GCC AAT GGG ACC 336 Thr Thr Val Leu Gln Asp Glu Arg Phe Phe Pr - #o Tyr Ala Asn Gly Thr 100 - # 105 - # 110 - - CTG GGC ATT CGA GAC CTC CAG GCC AAT GAC AC - #C GGA CGC TAC TTC TGC 384 Leu Gly Ile Arg Asp Leu Gln Ala Asn Asp Th - #r Gly Arg Tyr Phe Cys 115 - # 120 - # 125 - - CTG GCT GCC AAT GAC CAA AAC AAT GTT ACC AT - #C ATG GCT AAC CTG AAG 432 Leu Ala Ala Asn Asp Gln Asn Asn Val Thr Il - #e Met Ala Asn Leu Lys 130 - # 135 - # 140 - - GTT AAA GAT GCA ACT CAG ATC ACT CAG GGG CC - #C CGC AGC ACA ATC GAG 480 Val Lys Asp Ala Thr Gln Ile Thr Gln Gly Pr - #o Arg Ser Thr Ile Glu 145 1 - #50 1 - #55 1 - #60 - - AAG AAA GGT TCC AGG GTG ACC TTC ACG TGC CA - #G GCC TCC TTT GAC CCC 528 Lys Lys Gly Ser Arg Val Thr Phe Thr Cys Gl - #n Ala Ser Phe Asp Pro 165 - # 170 - # 175 - - TCC TTG CAG CCC AGC ATC ACC TGG CGT GGG GA - #C GGT CGA GAC CTC CAG 576 Ser Leu Gln Pro Ser Ile Thr Trp Arg Gly As - #p Gly Arg Asp Leu Gln 180 - # 185 - # 190 - - GAG CTT GGG GAC AGT GAC AAG TAC TTC ATA GA - #G GAT GGG CGC CTG GTC 624 Glu Leu Gly Asp Ser Asp Lys Tyr Phe Ile Gl - #u Asp Gly Arg Leu Val 195 - # 200 - # 205 - - ATC CAC AGC CTG GAC TAC AGC GAC CAG GGC AA - #C TAC AGC TGC GTG GCC 672 Ile His Ser Leu Asp Tyr Ser Asp Gln Gly As - #n Tyr Ser Cys Val Ala 210 - # 215 - # 220 - - AGT ACC GAA CTG GAT GTG GTG GAG AGT AGG GC - #A CAG CTC TTG GTG GTG 720 Ser Thr Glu Leu Asp Val Val Glu Ser Arg Al - #a Gln Leu Leu Val Val 225 2 - #30 2 - #35 2 - #40 - - GGG AGC CCT GGG CCG GTG CCA CGG CTG GTG CT - #G TCC GAC CTG CAC CTG 768 Gly Ser Pro Gly Pro Val Pro Arg Leu Val Le - #u Ser Asp Leu His Leu 245 - # 250 - # 255 - - CTG ACG CAG AGC CAG GTG CGC GTG TCC TGG AG - #T CCT GCA GAA GAC CAC 816 Leu Thr Gln Ser Gln Val Arg Val Ser Trp Se - #r Pro Ala Glu Asp His 260 - # 265 - # 270 - - AAT GCC CCC ATT GAG AAA TAT GAC ATT GAA TT - #T GAG GAC AAG GAA ATG 864 Asn Ala Pro Ile Glu Lys Tyr Asp Ile Glu Ph - #e Glu Asp Lys Glu Met 275 - # 280 - # 285 - - GCG CCT GAA AAA TGG TAC AGT CTG GGC AAG GT - #T CCA GGG AAC CAG ACC 912 Ala Pro Glu Lys Trp Tyr Ser Leu Gly Lys Va - #l Pro Gly Asn Gln Thr 290 - # 295 - # 300 - - TCT ACC ACC CTC AAG CTG TCG CCC TAT GTC CA - #C TAC ACC TTT AGG GTT 960 Ser Thr Thr Leu Lys Leu Ser Pro Tyr Val Hi - #s Tyr Thr Phe Arg Val 305 3 - #10 3 - #15 3 - #20 - - ACT GCC ATA AAC AAA TAT GGC CCC GGG GAG CC - #C AGC CCG GTC TCT GAG 1008 Thr Ala Ile Asn Lys Tyr Gly Pro Gly Glu Pr - #o Ser Pro Val Ser Glu 325 - # 330 - # 335 - - ACT GTG GTC ACA CCT GAG GCA GCC CCA GAG AA - #G AAC CCT GTG GAT GTG 1056 Thr Val Val Thr Pro Glu Ala Ala Pro Glu Ly - #s Asn Pro Val Asp Val 340 - # 345 - # 350 - - AAG GGG GAA GGA AAT GAG ACC ACC AAT ATG GT - #C ATC ACG TGG AAG CCG 1104 Lys Gly Glu Gly Asn Glu Thr Thr Asn Met Va - #l Ile Thr Trp Lys Pro 355 - # 360 - # 365 - - CTC CGG TGG ATG GAC TGG AAC GCC CCC CAG GT - #T CAG TAC CGC GTG CAG 1152 Leu Arg Trp Met Asp Trp Asn Ala Pro Gln Va - #l Gln Tyr Arg Val Gln 370 - # 375 - # 380 - - TGG CGC CCT CAG GGG ACA CGA GGG CCC TGG CA - #G GAG CAG ATT GTC AGC 1200 Trp Arg Pro Gln Gly Thr Arg Gly Pro Trp Gl - #n Glu Gln Ile Val Ser 385 3 - #90 3 - #95 - #400 - - GAC CCC TTC CTG GTG GTG TCC AAC ACG TCC AC - #C TTC GTG CCC TAT GAG 1248 Asp Pro Phe Leu Val Val Ser Asn Thr Ser Th - #r Phe Val Pro Tyr Glu 405 - # 410 - # 415 - - ATC AAA GTC CAG GCC GTC AAC AGC CAG GGC AA - #G GGA CCA GAG CCC CAG 1296 Ile Lys Val Gln Ala Val Asn Ser Gln Gly Ly - #s Gly Pro Glu Pro Gln 420 - # 425 - # 430 - - GTC ACT ATC GGC TAC TCT GGA GAG GAC TAC CC - #C CAG GCA ATC CCT GAG 1344 Val Thr Ile Gly Tyr Ser Gly Glu Asp Tyr Pr - #o Gln Ala Ile Pro Glu 435 - # 440 - # 445 - - CTG GAA GGC ATT GAA ATC CTC AAC TCA AGT GC - #C GTG CTG GTC AAG TGG 1392 Leu Glu Gly Ile Glu Ile Leu Asn Ser Ser Al - #a Val Leu Val Lys Trp 450 - # 455 - # 460 - - CGG CCG GTG GAC CTG GCC CAG GTC AAG GGC CA - #C CTC CGC GGA TAC AAT 1440 Arg Pro Val Asp Leu Ala Gln Val Lys Gly Hi - #s Leu Arg Gly Tyr Asn 465 4 - #70 4 - #75 4 - #80 - - GTG ACG TAC TGG AGG GAG GGC AGT CAG AGG AA - #G CAC AGC AAG AGA CAT 1488 Val Thr Tyr Trp Arg Glu Gly Ser Gln Arg Ly - #s His Ser Lys Arg His 485 - # 490 - # 495 - - ATC CAC AAA GAC CAT GTG GTG GTG CCC GCC AA - #C ACC ACC AGT GTC ATC 1536 Ile His Lys Asp His Val Val Val Pro Ala As - #n Thr Thr Ser Val Ile 500 - # 505 - # 510 - - CTC AGT GGC TTG CGG CCC TAT AGC TCC TAC CA - #C CTG GAG GTG CAG GCC 1584 Leu Ser Gly Leu Arg Pro Tyr Ser Ser Tyr Hi - #s Leu Glu Val Gln Ala 515 - # 520 - # 525 - - TTT AAC GGG CGA GGA TCG GGG CCC GCC AGC GA - #G TTC ACC TTC AGC ACC 1632 Phe Asn Gly Arg Gly Ser Gly Pro Ala Ser Gl - #u Phe Thr Phe Ser Thr 530 - # 535 - # 540 - - CCA GAG GGA GTG CCT GGC CAC CCC GAG GCG TT - #G CAC CTG GAG TGC CAG 1680 Pro Glu Gly Val Pro Gly His Pro Glu Ala Le - #u His Leu Glu Cys Gln 545 5 - #50 5 - #55 5 - #60 - - TCG AAC ACC AGC CTG CTG CTG CGC TGG CAG CC - #C CCA CTC AGC CAC AAC 1728 Ser Asn Thr Ser Leu Leu Leu Arg Trp Gln Pr - #o Pro Leu Ser His Asn 565 - # 570 - # 575 - - GGC GTG CTC ACC GGC TAC GTG CTC TCC TAC CA - #C CCC CTG GAT GAG GGG 1776 Gly Val Leu Thr Gly Tyr Val Leu Ser Tyr Hi - #s Pro Leu Asp Glu Gly 580 - # 585 - # 590 - - GGC AAG GGG CAA CTG TCC TTC AAC CTT CGG GA - #C CCC GAA CTT CGG ACA 1824 Gly Lys Gly Gln Leu Ser Phe Asn Leu Arg As - #p Pro Glu Leu Arg Thr 595 - # 600 - # 605 - - CAC AAC CTG ACC GAT CTC AGC CCC CAC CTG CG - #G TAC CGC TTC CAG CTT 1872 His Asn Leu Thr Asp Leu Ser Pro His Leu Ar - #g Tyr Arg Phe Gln Leu 610 - # 615 - # 620 - - CAG GCC ACC ACC AAA GAG GGC CCT GGT GAA GC - #C ATC GTA CGG GAA GGA 1920 Gln Ala Thr Thr Lys Glu Gly Pro Gly Glu Al - #a Ile Val Arg Glu Gly 625 6 - #30 6 - #35 6 - #40 - - GGC ACT ATG GCC TTG TCT GGG ATC TCA GAT TT - #T GGC AAC ATC TCA GCC 1968 Gly Thr Met Ala Leu Ser Gly Ile Ser Asp Ph - #e Gly Asn Ile Ser Ala 645 - # 650 - # 655 - - ACA GCG GGT GAA AAC TAC AGT GTC GTC TCC TG - #G GTC CCC AAG GAG GGC 2016 Thr Ala Gly Glu Asn Tyr Ser Val Val Ser Tr - #p Val Pro Lys Glu Gly 660 - # 665 - # 670 - - CAG TGC AAC TTC AGG TTC CAT ATC TTG TTC AA - #A GCC TTG GGA GAA GAG 2064 Gln Cys Asn Phe Arg Phe His Ile Leu Phe Ly - #s Ala Leu Gly Glu Glu 675 - # 680 - # 685 - - AAG GGT GGG GCT TCC CTT TCG CCA CAG TAT GT - #C AGC TAC AAC CAG AGC 2112 Lys Gly Gly Ala Ser Leu Ser Pro Gln Tyr Va - #l Ser Tyr Asn Gln Ser 690 - # 695 - # 700 - - TCC TAC ACG CAG TGG GAC CTG CAG CCT GAC AC - #T GAC TAC GAG ATC CAC 2160 Ser Tyr Thr Gln Trp Asp Leu Gln Pro Asp Th - #r Asp Tyr Glu Ile His 705 7 - #10 7 - #15 7 - #20 - - TTG TTT AAG GAG AGG ATG TTC CGG CAC CAA AT - #G GCT GTG AAG ACC

AAT 2208 Leu Phe Lys Glu Arg Met Phe Arg His Gln Me - #t Ala Val Lys Thr Asn 725 - # 730 - # 735 - - GGC ACA GGC CGC GTG AGG CTC CCT CCT GCT GG - #C TTC GCC ACT GAG GGC 2256 Gly Thr Gly Arg Val Arg Leu Pro Pro Ala Gl - #y Phe Ala Thr Glu Gly 740 - # 745 - # 750 - - TGG TTC ATC GGC TTT GTG AGT GCC ATC ATC CT - #C CTG CTC CTC GTC CTG 2304 Trp Phe Ile Gly Phe Val Ser Ala Ile Ile Le - #u Leu Leu Leu Val Leu 755 - # 760 - # 765 - - CTC ATC CTC TGC TTC ATC AAG CGC AGC AAG GG - #C GGC AAA TAC TCA GTG 2352 Leu Ile Leu Cys Phe Ile Lys Arg Ser Lys Gl - #y Gly Lys Tyr Ser Val 770 - # 775 - # 780 - - AAG GAT AAG GAG GAC ACC CAG GTG GAC TCT GA - #G GCC CGA CCG ATG AAA 2400 Lys Asp Lys Glu Asp Thr Gln Val Asp Ser Gl - #u Ala Arg Pro Met Lys 785 7 - #90 7 - #95 8 - #00 - - GAT GAG ACC TTC GGC GAG TAC AGG TCC CTG GA - #G AGT GAC AAC GAG GAG 2448 Asp Glu Thr Phe Gly Glu Tyr Arg Ser Leu Gl - #u Ser Asp Asn Glu Glu 805 - # 810 - # 815 - - AAG GCC TTT GGC AGC AGC CAG CCA TCG CTC AA - #C GGG GAC ATC AAG CCC 2496 Lys Ala Phe Gly Ser Ser Gln Pro Ser Leu As - #n Gly Asp Ile Lys Pro 820 - # 825 - # 830 - - CTG GGC AGT GAC GAC AGC CTG GCC GAT TAT GG - #G GGC AGC GTG GAT GTT 2544 Leu Gly Ser Asp Asp Ser Leu Ala Asp Tyr Gl - #y Gly Ser Val Asp Val 835 - # 840 - # 845 - - CAG TTC AAC GAG GAT GGT TCG TTC ATT GGC CA - #G TAC AGT GGC AAG AAG 2592 Gln Phe Asn Glu Asp Gly Ser Phe Ile Gly Gl - #n Tyr Ser Gly Lys Lys 850 - # 855 - # 860 - - GAG AAG GA - # - # - # 2600 Glu Lys 865 - - (2) INFORMATION FOR SEQ ID NO:5: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 1794 (B) TYPE: nucleic acid (C) STRANDEDNESS: sing - #le (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: nucleic acids - - (iii) HYPOTHETICAL: irrelevant - - (iv) ANTI-SENSE: no - - (vi) ORIGINAL SOURCE: (A) ORGANISM: homo sapi - #ens (B) INDIVIDUAL ISOLATE: - #17-18 week fetus - - (vii) IMMEDIATE SOURCE: (A) LIBRARY: Stratagene - #cDNA Library 936206 (B) CLONE: 17 - - (x) PUBLICATION INFORMATION: (A) AUTHORS: Hlavi - #n, Mary Louise Lemmon, V - #ance (B) TITLE: - #Molecular structure and functional testing of human L1C - #AM: an interspecies comparison. (C) JOURNAL: GENOM - #ICS (D) VOLUME: 11 (E) ISSUE: (F) PAGES: - #416-423 (G) DATE: - # 1991 (K) RELEVANT RESIDUES I - #N SEQ ID NO: 2731 to 4503 - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO: - # 5: - - NGG CCC GCC AGC GAG TTC ACC TTC AGC ACC CC - #A GAG GGA GTG CCT GGC 48 Xxx Pro Ala Ser Glu Phe Thr Phe Ser Thr Pr - #o Glu Gly Val Pro Gly 1 5 - # 10 - # 15 - - CAC CCC GAG GCG TTG CAC CTG GAG TGC CAG TC - #G AAC ACC AGC CTG CTG 96 His Pro Glu Ala Leu His Leu Glu Cys Gln Se - #r Asn Thr Ser Leu Leu 20 - # 25 - # 30 - - CTG CGC TGG CAG CCC CCA CTC AGC CAC AAC GG - #C GTG CTC ACC GGC TAC 144 Leu Arg Trp Gln Pro Pro Leu Ser His Asn Gl - #y Val Leu Thr Gly Tyr 35 - # 40 - # 45 - - GTG CTC TCC TAC CAC CCC CTG GAT GAG GGG GG - #C AAG GGG CAA CTG TCC 192 Val Leu Ser Tyr His Pro Leu Asp Glu Gly Gl - #y Lys Gly Gln Leu Ser 50 - # 55 - # 60 - - TTC AAC CTT CGG GAC CCC GAA CTT CGG ACA CA - #C AAC CTG ACC GAT CTC 240 Phe Asn Leu Arg Asp Pro Glu Leu Arg Thr Hi - #s Asn Leu Thr Asp Leu 65 - #70 - #75 - #80 - - AGC CCC CAC CTG CGG TAC CGC TTC CAG CTT CA - #G GCC ACC ACC AAA GAG 288 Ser Pro His Leu Arg Tyr Arg Phe Gln Leu Gl - #n Ala Thr Thr Lys Glu 85 - # 90 - # 95 - - GGC CCT GGT GAA GCC ATC GTA CGG GAA GGA GG - #C ACT ATG GCC TTG TCT 336 Gly Pro Gly Glu Ala Ile Val Arg Glu Gly Gl - #y Thr Met Ala Leu Ser 100 - # 105 - # 110 - - GGG ATC TCA GAT TTT GGC AAC ATC TCA GCC AC - #A GCG GGT GAA AAC TAC 384 Gly Ile Ser Asp Phe Gly Asn Ile Ser Ala Th - #r Ala Gly Glu Asn Tyr 115 - # 120 - # 125 - - AGT GTC GTC TCC TGG GTC CCC AAG GAG GGC CA - #G TGC AAC TTC AGG TTC 432 Ser Val Val Ser Trp Val Pro Lys Glu Gly Gl - #n Cys Asn Phe Arg Phe 130 - # 135 - # 140 - - CAT ATC TTG TTC AAA GCC TTG GGA GAA GAG AA - #G GGT GGG GCT TCC CTT 480 His Ile Leu Phe Lys Ala Leu Gly Glu Glu Ly - #s Gly Gly Ala Ser Leu 145 1 - #50 1 - #55 1 - #60 - - TCG CCA CAG TAT GTC AGC TAC AAC CAG AGC TC - #C TAC ACG CAG TGG GAC 528 Ser Pro Gln Tyr Val Ser Tyr Asn Gln Ser Se - #r Tyr Thr Gln Trp Asp 165 - # 170 - # 175 - - CTG CAG CCT GAC ACT GAC TAC GAG ATC CAC TT - #G TTT AAG GAG AGG ATG 576 Leu Gln Pro Asp Thr Asp Tyr Glu Ile His Le - #u Phe Lys Glu Arg Met 180 - # 185 - # 190 - - TTC CGG CAC CAA ATG GCT GTG AAG ACC AAT GG - #C ACA GGC CGC GTG AGG 624 Phe Arg His Gln Met Ala Val Lys Thr Asn Gl - #y Thr Gly Arg Val Arg 195 - # 200 - # 205 - - CTC CCT CCT GCT GGC TTC GCC ACT GAG GGC TG - #G TTC ATC GGC TTT GTG 672 Leu Pro Pro Ala Gly Phe Ala Thr Glu Gly Tr - #p Phe Ile Gly Phe Val 210 - # 215 - # 220 - - AGT GCC ATC ATC CTC CTG CTC CTC GTC CTG CT - #C ATC CTC TGC TTC ATC 720 Ser Ala Ile Ile Leu Leu Leu Leu Val Leu Le - #u Ile Leu Cys Phe Ile 225 2 - #30 2 - #35 2 - #40 - - AAG CGC AGC AAG GGC GGC AAA TAC TCA GTG AA - #G GAT AAG GAG GAC ACC 768 Lys Arg Ser Lys Gly Gly Lys Tyr Ser Val Ly - #s Asp Lys Glu Asp Thr 245 - # 250 - # 255 - - CAG GTG GAC TCT GAG GCC CGA CCG ATG AAA GA - #T GAG ACC TTC GGC GAG 816 Gln Val Asp Ser Glu Ala Arg Pro Met Lys As - #p Glu Thr Phe Gly Glu 260 - # 265 - # 270 - - TAC AGG TCC CTG GAG AGT GAC AAC GAG GAG AA - #G GCC TTT GGC AGC AGC 864 Tyr Arg Ser Leu Glu Ser Asp Asn Glu Glu Ly - #s Ala Phe Gly Ser Ser 275 - # 280 - # 285 - - CAG CCA TCG CTC AAC GGG GAC ATC AAG CCC CT - #G GGC AGT GAC GAC AGC 912 Gln Pro Ser Leu Asn Gly Asp Ile Lys Pro Le - #u Gly Ser Asp Asp Ser 290 - # 295 - # 300 - - CTG GCC GAT TAT GGG GGC AGC GTG GAT GTT CA - #G TTC AAC GAG GAT GGT 960 Leu Ala Asp Tyr Gly Gly Ser Val Asp Val Gl - #n Phe Asn Glu Asp Gly 305 3 - #10 3 - #15 3 - #20 - - TCG TTC ATT GGC CAG TAC AGT GGC AAG AAG GA - #G AAG GAG GCG GCA GGG 1008 Ser Phe Ile Gly Gln Tyr Ser Gly Lys Lys Gl - #u Lys Glu Ala Ala Gly 325 - # 330 - # 335 - - GGC AAT GAC AGC TCA GGG GCC ACT TCC CCC AT - #C AAC CCT GCC GTG GCC 1056 Gly Asn Asp Ser Ser Gly Ala Thr Ser Pro Il - #e Asn Pro Ala Val Ala 340 - # 345 - # 350 - - CTA GAA TAGTGGAG TACGGACAGG AGATGCTGTG CCCCCTGGCC TTGG - #GATCCA 1110 Leu Glu - - GGCCCCTCCC TCTCCAGCAG GCCCATGGGA GGCTGGAGTT GGGGCAGAGG AG - #AACTTGCT 1170 - - GCCTCGGATC CCCTTCCTAC CACCCGGTCC CCACTTTATT GCCAAAACCC AG - #CTGCACCC 1230 - - CTTCCTGGGC ACACGCTGCT CTGCCCCAGC TTGGGCAGAT CTCCCACATG CC - #AGGGGCCT 1290 - - TTGGGTGCTG TTTTGCCAGC CCATTTGGGC AGAGAGGCTG TGGTTTGGGG GA - #GAAGAAGT 1350 - - AGGGGTGGCC CGAAAGGTCT CCGAAATGCT GTCTTTCTTG CTCCCTGACT GG - #GGGCAGAC 1410 - - ATGGTGGGGT CTCCTCAGGA CCAGGGTTGG CACCTTCCCC CTCCCCCAGC CA - #CCACTCCA 1470 - - GCAGCCTGGC TGGGACTGGG AACAGAACTC GTGTCCCCAC CATCTGCTGT CT - #TTTCTTTG 1530 - - CCATCTCTGC TCCAACCGGG ATGGCAGCCG GGCAAACTGG CCGCGGGGGC AG - #GGGAGGCC 1590 - - ATCTGGAGAG CCCAGAGTCC CCCCACTCCC AGCATCGCAC TCTGGCAGCA CC - #GCCTCTTC 1650 - - CCGCCGCCCA GCCCACCCCA TGGCCGGCTT TCAGGAGCTC CATACACACG CT - #GCCTTCGG 1710 - - TACCCACCAC ACAACATCCA AGTGGCCTCC GTCACTACCT GGCTGCGGGG CG - #GGCACACC 1770 - - TCCTCCCACT GCCCACTGGC CGGC - # - # 1794 - - - - (2) INFORMATION FOR SEQ ID NO:6: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 1042 (B) TYPE: nucleic acid (C) STRANDEDNESS: sing - #le (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: nucleic acids - - (iii) HYPOTHETICAL: irrelevant - - (iv) ANTI-SENSE: no - - (vi) ORIGINAL SOURCE: (A) ORGANISM: homo sapi - #ens (B) INDIVIDUAL ISOLATE: - #17-18 week fetus - - (vii) IMMEDIATE SOURCE: (A) LIBRARY: Stratagene - #cDNA Library 936206 (B) CLONE: C2 - - (x) PUBLICATION INFORMATION: (A) AUTHORS: Hlavi - #n, Mary Louise Lemmon, V - #ance (B) TITLE: - #Molecular structure and functional testing of human L1C - #AM: an interspecies comparison. (C) JOURNAL: GENOM - #ICS (D) VOLUME: 11 (E) ISSUE: (F) PAGES: - #416-423 (G) DATE: - # 1991 (K) RELEVANT RESIDUES I - #N SEQ ID NO: -26 to 1016 - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO: - # 6: - - CGTGCTCCGC GGTGCCGCCG GGAAAG ATG GTC GTG GCG CTG - #CGG TAC GTG TGG 53 - # Met Val Val Ala - #Leu Arg Tyr Val Trp - # 1 - # 5 - - CCT CTC CTC CTC TGC AGC CCC TGC CTG CTT AT - #C CAG ATC CCC GAG GAA 101 Pro Leu Leu Leu Cys Ser Pro Cys Leu Leu Il - #e Gln Ile Pro Glu Glu 10 - # 15 - # 20 - # 25 - - TAT GAA GGA CAC CAT GTG ATG GAG CCA CCT GT - #C ATC ACG GAA CAG TCT 149 Tyr Glu Gly His His Val Met Glu Pro Pro Va - #l Ile Thr Glu Gln Ser 30 - # 35 - # 40 - - CCA CGG CGC CTG GTT GTC TTC CCC ACA GAT GA - #C ATC AGC CTC AAG TGT 197 Pro Arg Arg Leu Val Val Phe Pro Thr Asp As - #p Ile Ser Leu Lys Cys 45 - # 50 - # 55 - - GAG GCC AGT GGC AAG CCC GAA GTG CAG TTC CG - #C TGG ACG AGG GAT GGT 245 Glu Ala Ser Gly Lys Pro Glu Val Gln Phe Ar - #g Trp Thr Arg Asp Gly 60 - # 65 - # 70 - - GTC CAC TTC AAA CCC AAG GAA GAG CTG GGT GT - #G ACC GTG TAC CAG TCG 293 Val His Phe Lys Pro Lys Glu Glu Leu Gly Va - #l Thr Val Tyr Gln Ser 75 - # 80 - # 85 - - CCC CAC TCT GGC TCC TTC ACC ATC ACG GGC AA - #C AAC AGC AAC TTT GCT 341 Pro His Ser Gly Ser Phe Thr Ile Thr Gly As - #n Asn Ser Asn Phe Ala 90 - # 95 - #100 - #105 - - CAG AGG TTC CAG GGC ATC TAC CGC TGC TTT GC - #C AGC AAT AAG CTG GGC

389 Gln Arg Phe Gln Gly Ile Tyr Arg Cys Phe Al - #a Ser Asn Lys Leu Gly 110 - # 115 - # 120 - - ACC GCC ATG TCC CAT GAG ATC CGG CTC ATG GC - #C GAG GGT GCC CCC AAG 437 Thr Ala Met Ser His Glu Ile Arg Leu Met Al - #a Glu Gly Ala Pro Lys 125 - # 130 - # 135 - - TGG CCA AAG GAG ACA GTG AAG CCC GTG GAG GT - #G GAG GAA GGG GAG TCA 485 Trp Pro Lys Glu Thr Val Lys Pro Val Glu Va - #l Glu Glu Gly Glu Ser 140 - # 145 - # 150 - - GTG GTT CTG CCT TGC AAC CCT CCC CCA AGT GC - #A GAG CCT CTC CGG ATC 533 Val Val Leu Pro Cys Asn Pro Pro Pro Ser Al - #a Glu Pro Leu Arg Ile 155 - # 160 - # 165 - - TAC TGG ATG AAC AGC AAG ATC TTG CAC ATC AA - #G CAG GAC GAG CGG GTG 581 Tyr Trp Met Asn Ser Lys Ile Leu His Ile Ly - #s Gln Asp Glu Arg Val 170 1 - #75 1 - #80 1 - #85 - - ACG ATG GGC CAG AAC GGC AAC CTC TAC TTT GC - #C AAT GTG CTC ACC TCC 629 Thr Met Gly Gln Asn Gly Asn Leu Tyr Phe Al - #a Asn Val Leu Thr Ser 190 - # 195 - # 200 - - GAC AAC CAC TCA GAC TAC ATC TGC CAC GCC CA - #C TTC CCA GGC ACC AGG 677 Asp Asn His Ser Asp Tyr Ile Cys His Ala Hi - #s Phe Pro Gly Thr Arg 205 - # 210 - # 215 - - ACC ATC ATT CAG AAG GAA CCC ATT GAC CTC CG - #G GTC AAG GCC ACC AAC 725 Thr Ile Ile Gln Lys Glu Pro Ile Asp Leu Ar - #g Val Lys Ala Thr Asn 220 - # 225 - # 230 - - AGC ATG ATT GAC AGG AAG CCG CGC CTG CTC TT - #C CCC ACC AAC TCC AGC 773 Ser Met Ile Asp Arg Lys Pro Arg Leu Leu Ph - #e Pro Thr Asn Ser Ser 235 - # 240 - # 245 - - AGC CAC CTG GTG GCC TTG CAG GGG CAG CCA TT - #G GTC CTG GAG TGC ATC 821 Ser His Leu Val Ala Leu Gln Gly Gln Pro Le - #u Val Leu Glu Cys Ile 250 2 - #55 2 - #60 2 - #65 - - GCC GAG GGC TTT CCC ACG CCC ACC ATC AAA TG - #G CTG CGC CCC AGT GGC 869 Ala Glu Gly Phe Pro Thr Pro Thr Ile Lys Tr - #p Leu Arg Pro Ser Gly 270 - # 275 - # 280 - - CCC ATG CCA GCT GAC CGT GTC ACC TAC CAG AA - #C CAC AAC AAG ACC CTG 917 Pro Met Pro Ala Asp Arg Val Thr Tyr Gln As - #n His Asn Lys Thr Leu 285 - # 290 - # 295 - - CAG CTG CTG AAA GTG GGC GAG GAG GAT GAT GG - #C GAG TAC CGC TGC CTG 965 Gln Leu Leu Lys Val Gly Glu Glu Asp Asp Gl - #y Glu Tyr Arg Cys Leu 300 - # 305 - # 310 - - GCC GAG AAC TCA CTG GGC AGT GCC CGG CAT GC - #G TAC TAT GTC ACC GTG 1013 Ala Glu Asn Ser Leu Gly Ser Ala Arg His Al - #a Tyr Tyr Val Thr Val 315 - # 320 - # 325 - - GAG GCT GCC CCG TAC TGG CTG CAC AAG CC - # 1042 Glu Ala Ala Pro Tyr Trp Leu His Lys 330 3 - #35 - - - - (2) INFORMATION FOR SEQ ID NO: 7: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 50 (B) TYPE: nucleic acid (C) STRANDEDNESS: sing - #le (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: oligonucleotide - - (iii) HYPOTHETICAL: irrelevant - - (iv) ANTI-SENSE: no - - (vi) ORIGINAL SOURCE: (A) ORGANISM: mouse - - (x) SEQUENCE DESCRIPTION: SEQ ID - #NO: 7: - - GAGGACACCC AGGTGGACTC TGAGGCCCGA CCGATGAAAG ATGAGACCTT - # 50 - - - - (2) INFORMATION FOR SEQ ID NO: 8: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 40 (B) TYPE: nucleic acid (C) STRANDEDNESS: sing - #le (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: oligonucleotide - - (iii) HYPOTHETICAL: irrelevant - - (iv) ANTI-SENSE: no - - (x) SEQUENCE DESCRIPTION: SEQ ID - #NO: 8: - - TGCCACGCCC ACTTCCCAGG CACCAGGACC ATCATTCAGA - # - # 40 - - - - (2) INFORMATION FOR SEQ ID NO: 9: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 95 (B) TYPE: amino acid (C) STRANDEDNESS: sing - #le (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: amino acids - - (iii) HYPOTHETICAL: irrelevant - - (iv) ANTI-SENSE: no - - (vi) ORIGINAL SOURCE: (A) ORGANISM: mouse (B) INDIVIDUAL ISOLATE: - # 8 day old mouse brain - - (vii) IMMEDIATE SOURCE: (A) LIBRARY: lamda - #GT 10 and lamda GT11 (B) CLONE: synthesis - #of several clones - - (x) PUBLICATION INFORMATION: (A) AUTHORS: Moos, - #M. Tacke, R. Scherer, - #H. Teplow, D - #. Fruh, K. Schachner, - #M. (B) TITLE: Neu - #ral adhesion molecule L1 is a member of - # the immunoglobulin superfamily - #with binding domains similar t - #o fibronectin (C) JOURNAL: NATURE (D) VOLUME: 334 (E) ISSUE: (F) PAGES: 701 - #-703 (G) DATE: - #1988 - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO: - # 9: - - Val Ile Thr Glu Gln Ser Pro Arg Arg Leu Va - #l Val Phe Pro Thr Asp Asp 1 5 - # 10 - # 15 - - Ile Ser Leu Lys Cys Glu Ala Arg Gly Arg Pr - #o Gln Val Glu Phe Arg Trp 20 - # 25 - # 30 - - Thr Lys Asp Gly Ile His Phe Lys Pro Lys Gl - #u Glu Leu Gly Val Val Val 35 - # 40 - # 45 - # 50 - - His Glu Ala Pro Tyr Ser Gly Ser Phe Thr Il - #e Glu Gly Asn Asn Ser Phe 55 - # 60 - # 65 - - Ala Gln Arg Phe Gln Gly Ile Tyr Arg Cys Ty - #r Ala Ser Asn Lys Leu Gly 70 - # 75 - # 80 - # 85 - - Thr Ala Met Ser His Glu Ile Gln Leu Val 90 - # 95 - - - - (2) INFORMATION FOR SEQ ID NO: 10: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 106 (B) TYPE: amino acid (C) STRANDEDNESS: sing - #le (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: amino acids - - (iii) HYPOTHETICAL: irrelevant - - (iv) ANTI-SENSE: no - - (vi) ORIGINAL SOURCE: (A) ORGANISM: mouse (B) INDIVIDUAL ISOLATE: - # 8 day old mouse brain - - (vii) IMMEDIATE SOURCE: (A) LIBRARY: lamda - #GT 10 and lamda GT11 (B) CLONE: synthesis - #of several clones - - (x) PUBLICATION INFORMATION: (A) AUTHORS: Moos, M. Tacke, R. Scherer, - #H. Teplow, D - #. Fruh, K. Schachner, - #M. (B) TITLE: Neural - #adhesion molecule L1 is a member of - # the immunoglobulin superfamily - #with binding domains similar t - #o fibronectin (C) JOURNAL: NATURE (D) VOLUME: 334 (E) ISSUE: (F) PAGES: 701-703 (G) DATE: 1988 - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO: - # 10: - - Ala Glu Gly Ala Pro Lys Trp Pro Lys Glu Th - #r Val Lys Pro Val Glu Val 1 5 - # 10 - # 15 - - Glu Glu Gly Glu Ser Val Val Leu Pro Cys As - #n Pro Pro Pro Ser Ala Ala 20 - # 25 - # 30 - - Pro Pro Arg Ile Tyr Trp Met Asn Ser Lys Il - #e Phe Asp Ile Lys Gln Asp 35 - # 40 - # 45 - # 50 - - Glu Arg Val Ser Met Gly Gln Asn Gly Asp Le - #u Tyr Phe Ala Asn Val Leu 55 - # 60 - # 65 - - Thr Ser Asp Asn His Ser Asp Tyr Ile Cys As - #n Ala His Phe Pro Gly Thr 70 - # 75 - # 80 - # 85 - - Arg Thr Ile Ile Gln Lys Glu Pro Ile Asp Le - #u Arg Val Lys Pro Thr Asn 90 - # 95 - # 100 - - Ser Met Ile Asp 105 - - - - (2) INFORMATION FOR SEQ ID NO: 11: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 96 (B) TYPE: amino acid (C) STRANDEDNESS: sing - #le (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: amino acids - - (iii) HYPOTHETICAL: irrelevant - - (iv) ANTI-SENSE: no - - (vi) ORIGINAL SOURCE: (A) ORGANISM: mouse (B) INDIVIDUAL ISOLATE: - # 8 day old mouse brain - - (vii) IMMEDIATE SOURCE: (A) LIBRARY: lamda - #GT 10 and lamda GT11 (B) CLONE: synthesis - #of several clones - - (x) PUBLICATION INFORMATION: (A) AUTHORS: Moos, - #M. Tacke, R. Scherer, - #H. Teplow, D - #. Fruh, K. Schachner, - #M. (B) TITLE: Neu - #ral adhesion molecule L1 is a member of - # the immunoglobulin superfamily - #with binding domains similar t - #o fibronectin (C) JOURNAL: NATURE (D) VOLUME: 334 (E) ISSUE: (F) PAGES: 701 - #-703 (G) DATE: - #1988 - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO: - # 11: - - Arg Lys Pro Arg Leu Leu Phe Pro Thr Asn Se - #r Ser Ser Arg Leu Val Ala 1 5 - # 10 - # 15 - - Leu Gln Gly Gln Ser Leu Ile Leu Glu Cys Il - #e Ala Glu Gly Phe Pro Thr 20 - # 25 - # 30 - - Pro Thr Ile Lys Trp Leu His Pro Ser Asp Pr - #o Met Pro Thr Asp Arg Val 35 - # 40 - # 45 - # 50 - - Ile Tyr Gln Asn His Asn Lys Thr Leu Gln Le - #u Leu Asn Val Gly Glu Glu 55 - # 60 - # 65 - - Asp Asp Gly Glu Tyr Thr Cys Leu Ala Glu As - #n Ser Leu Gly Ser Ala Arg 70 - # 75 - # 80 - # 85 - - His Ala Tyr Tyr Val Thr Val Glu Ala Ala Pr - #o 90 - # 95 - - - - (2) INFORMATION FOR SEQ ID NO: 12: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 92 (B) TYPE: amino acid (C) STRANDEDNESS: sing - #le (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: amino acids - - (iii) HYPOTHETICAL: irrelevant - - (iv) ANTI-SENSE: no - - (vi) ORIGINAL SOURCE: (A) ORGANISM: mouse (B) INDIVIDUAL ISOLATE: - # 8 day old mouse brain

- - (vii) IMMEDIATE SOURCE: (A) LIBRARY: lamda - #GT 10 and lamda GT11 (B) CLONE: synthesis - #of several clones - - (x) PUBLICATION INFORMATION: (A) AUTHORS: Moos, - # M. Tacke, R. Scherer, - #H. Teplow, D - #. Fruh, K. Schachner, - #M. (B) TITLE: - #Neural adhesion molecule L1 is a member of - # the immunoglobulin superfamily - #with binding domains similar t - #o fibronectin (C) JOURNAL: NATURE (D) VOLUME: 334 (E) ISSUE: (F) PAGES: 701 - #-703 (G) DATE: - #1988 - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO: - # 12: - - Tyr Trp Leu Gln Lys Pro Gln Ser His Leu Ty - #r Gly Pro Gly Glu Thr Ala 1 5 - # 10 - # 15 - - Arg Leu Asp Cys Gln Val Gln Gly Arg Pro Gl - #n Pro Glu Ile Thr Trp Arg 20 - # 25 - # 30 - - Ile Asn Gly Met Ser Met Glu Thr Val Asn Ly - #s Asp Gln Lys Tyr Arg Ile 35 - # 40 - # 45 - # 50 - - Glu Gln Gly Ser Leu Ile Leu Ser Asn Val Gl - #n Pro Thr Asp Thr Met Val 55 - # 60 - # 65 - - Thr Gln Cys Glu Ala Arg Asn Gln His Gly Le - #u Leu Leu Ala Asn Ala Tyr 70 - # 75 - # 80 - # 85 - - Ile Tyr Val Val Gln Leu Pro 90 - - - - (2) INFORMATION FOR SEQ ID NO: 13: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 93 (B) TYPE: amino acid (C) STRANDEDNESS: sing - #le (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: amino acids - - (iii) HYPOTHETICAL: irrelevant - - (iv) ANTI-SENSE: no - - (vi) ORIGINAL SOURCE: (A) ORGANISM: mouse (B) INDIVIDUAL ISOLATE: - # 8 day old mouse brain - - (vii) IMMEDIATE SOURCE: (A) LIBRARY: lamda - #GT 10 and lamda GT11 (B) CLONE: synthesis - #of several clones - - (x) PUBLICATION INFORMATION: (A) AUTHORS: Moos, - #M. Tacke, R. Scherer, - #H. Teplow, D - #. Fruh, K. Schachner, - #M. (B) TITLE: Neu - #ral adhesion molecule L1 is a member of - # the immunoglobulin superfamily - #with binding domains similar t - #o fibronectin (C) JOURNAL: NATURE (D) VOLUME: 334 (E) ISSUE: (F) PAGES: 701 - #-703 (G) DATE: - #1988 - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO: - # 13: - - Ala Arg Ile Leu Thr Lys Asp Asn Gln Thr Ty - #r Met Ala Val Glu Gly Ser 1 5 - # 10 - # 15 - - Thr Ala Tyr Leu Leu Cys Lys Ala Phe Gly Al - #a Pro Val Pro Ser Val Gln 20 - # 25 - # 30 - - Trp Leu Asp Glu Glu Gly Thr Thr Val Leu Gl - #n Asp Glu Arg Phe Phe Pro 35 - # 40 - # 45 - # 50 - - Tyr Ala Asn Gly Thr Leu Ser Ile Arg Asp Le - #u Gln Ala Asn Asp Thr Gly 55 - # 60 - # 65 - - Arg Tyr Phe Cys Gln Ala Ala Asn Asp Gln As - #n Asn Val Ile Ile Leu Ala 70 - # 75 - # 80 - # 85 - - Asn Leu Gln Val Lys Glu Ala Thr 90 - - - - (2) INFORMATION FOR SEQ ID NO: 14: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 96 (B) TYPE: amino acid (C) STRANDEDNESS: sing - #le (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: amino acids - - (iii) HYPOTHETICAL: irrelevant - - (iv) ANTI-SENSE: no - - (vi) ORIGINAL SOURCE: (A) ORGANISM: mouse (B) INDIVIDUAL ISOLATE: - # 8 day old mouse brain - - (vii) IMMEDIATE SOURCE: (A) LIBRARY: lamda - #GT 10 and lamda GT11 (B) CLONE: synthesis - #of several clones - - (x) PUBLICATION INFORMATION: (A) AUTHORS: Moos, - # M. Tacke, R. Scherer, - #H. Teplow, D - #. Fruh, K. Schachner, - #M. (B) TITLE: - #Neural adhesion molecule L1 is a member of - # the immunoglobulin superfamily - #with binding domains similar t - #o fibronectin (C) JOURNAL: NATURE (D) VOLUME: 334 (E) ISSUE: (F) PAGES: 701 - #-703 (G) DATE: - # 1988 - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO: - # 14: - - Gln Ile Thr Gln Gly Pro Arg Ser Ala Ile Gl - #u Lys Lys Gly Ala Arg Val 1 5 - # 10 - # 15 - - Thr Phe Thr Cys Gln Ala Ser Phe Asp Pro Se - #r Leu Gln Ala Ser Ile Thr 20 - # 25 - # 30 - - Trp Arg Gly Asp Gly Arg Asp Leu Gln Glu Ar - #g Gly Asp Ser Asp Lys Tyr 35 - # 40 - # 45 - # 50 - - Phe Ile Glu Asp Gly Lys Leu Val Ile Gln Se - #r Leu Asp Tyr Ser Asp Gln 55 - # 60 - # 65 - - Gly Asn Tyr Ser Cys Val Ala Ser Thr Glu Le - #u Asp Glu Val Glu Ser Arg 70 - # 75 - # 80 - # 85 - - Ala Gln Leu Leu Val Val Gly Ser Pro Gly Pr - #o 90 - # 95 - - - - (2) INFORMATION FOR SEQ ID NO: 15: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 101 (B) TYPE: amino acid (C) STRANDEDNESS: sing - #le (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: amino acids - - (iii) HYPOTHETICAL: irrelevant - - (iv) ANTI-SENSE: no - - (vi) ORIGINAL SOURCE: (A) ORGANISM: mouse (B) INDIVIDUAL ISOLATE: - # 8 day old mouse brain - - (vii) IMMEDIATE SOURCE: (A) LIBRARY: lamda - #GT 10 and lamda GT11 (B) CLONE: synthesis - #of several clones - - (x) PUBLICATION INFORMATION: (A) AUTHORS: Moos, - #M. Tacke, R. Scherer, - #H. Teplow, D - #. Fruh, K. Schachner, - #M. (B) TITLE: Neu - #ral adhesion molecule L1 is a member of - # the immunoglobulin superfamily - #with binding domains similar t - #o fibronectin (C) JOURNAL: NATURE (D) VOLUME: 334 (E) ISSUE: (F) PAGES: 701 - #-703 (G) DATE: - #1988 - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO: - # 15: - - Val Pro His Leu Glu Leu Ser Asp Arg His Le - #u Leu Lys Gln Ser Gln Val 1 5 - # 10 - # 15 - - His Leu Ser Trp Ser Pro Ala Glu Asp His As - #n Ser Pro Ile Glu Lys Tyr 20 - # 25 - # 30 - - Asp Ile Glu Phe Glu Asp Lys Glu Met Ala Pr - #o Glu Lys Trp Phe Ser Leu 35 - # 40 - # 45 - # 50 - - Gly Lys Val Pro Gly Asn Gln Thr Ser Thr Th - #r Leu Lys Leu Ser Pro Tyr 55 - # 60 - # 65 - - Val His Tyr Thr Phe Arg Val Thr Ala Ile As - #n Lys Tyr Gly Pro Gly Glu 70 - # 75 - # 80 - # 85 - - Pro Ser Pro Val Ser Glu Ser Val Val Thr Pr - #o Glu Ala Ala Pro Glu 90 - # 95 - # 100 - - - - (2) INFORMATION FOR SEQ ID NO: 16: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 96 (B) TYPE: amino acid (C) STRANDEDNESS: sing - #le (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: amino acids - - (iii) HYPOTHETICAL: irrelevant - - (iv) ANTI-SENSE: no - - (vi) ORIGINAL SOURCE: (A) ORGANISM: mouse (B) INDIVIDUAL ISOLATE: - # 8 day old mouse brain - - (vii) IMMEDIATE SOURCE: (A) LIBRARY: lamda - #GT 10 and lamda GT11 (B) CLONE: synthesis - #of several clones - - (x) PUBLICATION INFORMATION: (A) AUTHORS: Moos, - #M. Tacke, R. Scherer, - #H. Teplow, D - #. Fruh, K. Schachner, - #M. (B) TITLE: Neu - #ral adhesion molecule L1 is a member of - # the immunoglobulin superfamily - #with binding domains similar t - #o fibronectin (C) JOURNAL: NATURE (D) VOLUME: 334 (E) ISSUE: (F) PAGES: 701 - #-703 (G) DATE: - #1988 - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO: - # 16: - - Lys Asn Pro Val Asp Val Arg Gly Glu Gly As - #n Glu Thr Asn Asn Met Val 1 5 - # 10 - # 15 - - Ile Thr Trp Lys Pro Leu Arg Trp Met Asp Tr - #p Asn Ala Pro Gln Ile Gln 20 - # 25 - # 30 - - Tyr Arg Val Gln Trp Arg Pro Gln Gly Lys Gl - #n Glu Thr Trp Arg Lys Gln 35 - # 40 - # 45 - # 50 - - Thr Val Ser Asp Pro Phe Leu Val Val Ser As - #n Thr Ser Thr Phe Val Pro 55 - # 60 - # 65 - - Tyr Glu Ile Lys Val Gln Ala Val Asn Asn Gl - #n Gly Lys Gly Pro Glu Pro 70 - # 75 - # 80 - # 85 - - Gln Val Thr Ile Gly Tyr Ser Gly Glu Asp Ty - #r 90 - # 95 - - - - (2) INFORMATION FOR SEQ ID NO: 17: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 106 (B) TYPE: amino acid (C) STRANDEDNESS: sing - #le

(D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: amino acids - - (iii) HYPOTHETICAL: irrelevant - - (iv) ANTI-SENSE: no - - (vi) ORIGINAL SOURCE: (A) ORGANISM: mouse (B) INDIVIDUAL ISOLATE: - # 8 day old mouse brain - - (vii) IMMEDIATE SOURCE: (A) LIBRARY: lamda - #GT 10 and lamda GT11 (B) CLONE: synthesis - #of several clones - - (x) PUBLICATION INFORMATION: (A) AUTHORS: Moos, - #M. Tacke, R. Scherer, - #H. Teplow, D - #. Fruh, K. Schachner, - #M. (B) TITLE: Neu - #ral adhesion molecule L1 is a member of - # the immunoglobulin superfamily - #with binding domains similar t - #o fibronectin (C) JOURNAL: NATURE (D) VOLUME: 334 (E) ISSUE: (F) PAGES: 701 - #-703 (G) DATE: - #1988 - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO: - # 17: - - Pro Gln Val Ser Pro Glu Leu Glu Asp Ile Th - #r Ile Phe Asn Ser Ser Thr 1 5 - # 10 - # 15 - - Val Leu Val Arg Trp Arg Pro Val Asp Leu Al - #a Gln Val Lys Gly His Leu 20 - # 25 - # 30 - - Lys Gly Tyr Asn Val Thr Tyr Trp Trp Lys Gl - #y Ser Gln Arg Lys His Ser 35 - # 40 - # 45 - # 50 - - Lys Arg His Ile His Lys Ser His Ile Val Va - #l Pro Ala Asn Thr Thr Ser 55 - # 60 - # 65 - - Ala Ile Leu Ser Gly Leu Arg Pro Tyr Ser Se - #r Tyr His Val Glu Val Gln 70 - # 75 - # 80 - # 85 - - Ala Phe Asn Gly Arg Gly Leu Gly Pro Ala Se - #r Glu Trp Thr Phe Ser Thr 90 - # 95 - # 100 - - Pro Glu Gly Val 105 - - - - (2) INFORMATION FOR SEQ ID NO: 18: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 98 (B) TYPE: amino acid (C) STRANDEDNESS: sing - #le (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: amino acids - - (iii) HYPOTHETICAL: irrelevant - - (iv) ANTI-SENSE: no - - (vi) ORIGINAL SOURCE: (A) ORGANISM: mouse (B) INDIVIDUAL ISOLATE: - # 8 day old mouse brain - - (vii) IMMEDIATE SOURCE: (A) LIBRARY: lamda - #GT 10 and lamda GT11 (B) CLONE: synthesis - #of several clones - - (x) PUBLICATION INFORMATION: (A) AUTHORS: - # Moos, M. Tacke, R. Scherer, - #H. Teplow, D - #. Fruh, K. Schachner, - #M. (B) TITLE: - # Neural adhesion molecule L1 is a member of - # the immunoglobulin superfamily - #with binding domains similar t - #o fibronectin (C) JOURNAL: NATURE (D) VOLUME: 334 (E) ISSUE: (F) PAGES: 701 - #-703 (G) DATE: - # 1988 - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO: - # 18: - - Pro Gly His Pro Glu Ala Leu His Leu Glu Cy - #s Gln Ser Asp Thr Ser Leu 1 5 - # 10 - # 15 - - Leu Leu His Trp Gln Pro Pro Leu Ser His As - #n Gly Val Leu Thr Gly Tyr 20 - # 25 - # 30 - - Leu Leu Ser Tyr His Pro Val Glu Gly Glu Se - #r Lys Glu Gln Leu Phe Phe 35 - # 40 - # 45 - # 50 - - Asn Leu Ser Asp Pro Glu Leu Arg Thr His As - #n Leu Thr Asn Leu Asn Pro 55 - # 60 - # 65 - - Asp Leu Gln Tyr Arg Phe Gln Leu Gln Ala Th - #r Thr Gln Gln Gly Gly Pro 70 - # 75 - # 80 - # 85 - - Gly Glu Ala Ile Val Arg Glu Gly Gly Thr Me - #t Ala Leu 90 - # 95 - - - - (2) INFORMATION FOR SEQ ID NO: 19: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 101 (B) TYPE: amino acid (C) STRANDEDNESS: sing - #le (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: amino acids - - (iii) HYPOTHETICAL: irrelevant - - (iv) ANTI-SENSE: no - - (vi) ORIGINAL SOURCE: (A) ORGANISM: mouse (B) INDIVIDUAL ISOLATE: - # 8 day old mouse brain - - (vii) IMMEDIATE SOURCE: (A) LIBRARY: lamda - #GT 10 and lamda GT11 (B) CLONE: synthesis - #of several clones - - (x) PUBLICATION INFORMATION: (A) AUTHORS: - # Moos, M. Tacke, R. Scherer, - #H. Teplow, D - #. Fruh, K. Schachner, - #M. (B) TITLE: - # Neural adhesion molecule L1 is a member of - # the immunoglobulin superfamily - #with binding domains similar t - #o fibronectin (C) JOURNAL: NATURE (D) VOLUME: 334 (E) ISSUE: (F) PAGES: 701 - #-703 (G) DATE: - # 1988 - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO: - # 19: - - Phe Gly Lys Pro Asp Phe Gly Asn Ile Ser Al - #a Thr Ala Gly Glu Asn Tyr 1 5 - # 10 - # 15 - - Ser Val Val Ser Trp Val Pro Arg Lys Gly Gl - #n Cys Asn Phe Arg Phe His 20 - # 25 - # 30 - - Ile Leu Phe Lys Ala Leu Pro Glu Gly Lys Va - #l Ser Pro Asp His Gln Pro 35 - # 40 - # 45 - # 50 - - Gln Pro Gln Tyr Val Ser Tyr Asn Gln Ser Se - #r Tyr Thr Gln Trp Asn Leu 55 - # 60 - # 65 - - Gln Pro Asp Thr Lys Tyr Glu Ile His Leu Il - #e Lys Glu Lys Val Leu Leu 70 - # 75 - # 80 - # 85 - - His His Leu Asp Val Lys Thr Asn Gly Thr Gl - #y Pro Val Arg Val Ser 90 - # 95 - # 100 - - - - (2) INFORMATION FOR SEQ ID NO: 20: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 145 (B) TYPE: amino acid (C) STRANDEDNESS: sing - #le (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: amino acids - - (iii) HYPOTHETICAL: irrelevant - - (iv) ANTI-SENSE: no - - (vi) ORIGINAL SOURCE: (A) ORGANISM: mouse (B) INDIVIDUAL ISOLATE: - # 8 day old mouse brain - - (vii) IMMEDIATE SOURCE: (A) LIBRARY: lamda - #GT 10 and lamda GT11 (B) CLONE: synthesis - #of several clones - - (x) PUBLICATION INFORMATION: (A) AUTHORS: - # Moos, M. Tacke, R. Scherer, - #H. Teplow, D - #. Fruh, K. Schachner, - #M. (B) TITLE: - # Neural adhesion molecule L1 is a member of - # the immunoglobulin superfamily - #with binding domains similar t - #o fibronectin (C) JOURNAL: NATURE (D) VOLUME: 334 (E) ISSUE: (F) PAGES: 701 - #-703 (G) DATE: - # 1988 - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO: - # 20: - - Thr Thr Gly Ser Phe Ala Ser Glu Gly Trp Ph - #e Ile Ala Phe Val Ser Ala 1 5 - # 10 - # 15 - - Ile Ile Leu Leu Leu Leu Ile Leu Leu Ile Le - #u Cys Phe Ile Lys Arg Ser 20 - # 25 - # 30 - - Lys Gly Gly Lys Tyr Ser Val Lys Asp Lys Gl - #u Asp Thr Gln Val Asp Ser 35 - # 40 - # 45 - # 50 - - Glu Ala Arg Pro Met Lys Asp Glu Thr Phe Gl - #y Glu Tyr Arg Ser Leu Glu 55 - # 60 - # 65 - - Ser Asp Asn Glu Glu Lys Ala Phe Gly Ser Se - #r Gln Pro Ser Leu Asn Gly 70 - # 75 - # 80 - # 85 - - Asp Ile Lys Pro Leu Gly Ser Asp Asp Ser Le - #u Ala Asp Tyr Gly Gly Ser 90 - # 95 - # 100 - - Val Asp Val Gln Phe Asn Glu Asp Gly Ser Ph - #e Ile Gly Gln Tyr Ser Gly 105 - # 110 - # 115 - - Lys Lys Glu Lys Glu Ala Ala Gly Gly Asn As - #p Ser Ser Gly Ala Thr Ser 120 1 - #25 1 - #30 1 - #35 - - Pro Ile Asn Pro Ala Val Ala Leu Glu 140 - # 145 - - - - (2) INFORMATION FOR SEQ ID NO: 21: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 96 (B) TYPE: amino acid (C) STRANDEDNESS: sing - #le (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: amino acids - - (iii) HYPOTHETICAL: irrelevant - - (iv) ANTI-SENSE: no - - (vi) ORIGINAL SOURCE: (A) ORGANISM: Homo - #Sapiens (B) INDIVIDUAL ISOLATE: - # 17-18 week fetus - - (vii) IMMEDIATE SOURCE: (A) LIBRARY: Stratagen - #e cDNA Library 936206 (B) CLONE: synthesis - #of 4 clones - - (x) PUBLICATION INFORMATION: (A) AUTHORS: Hlavin, - #Mary Louise Lemmon, V - #ance (B) TITLE: Mol - #ecular structure and functional testing o - #f human L1CAM: an interspecies comparison. (C) JOURNAL: GENOMICS (D) VOLUME: 11 (E) ISSUE: (F) PAGES: 416 - #-423 (G) DATE: - #1991 - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO: - # 21: - - Val Ile Thr Glu Gln Ser Pro Arg Arg Leu Va - #l Val Phe Pro Thr Asp Asp 1 5 - # 10 - # 15 - - Ile Ser Leu Lys Cys Glu Ala Ser Gly Lys Pr - #o Glu Val Gln Phe Arg Trp 20 - # 25 - # 30 - - Thr Arg Asp Gly Val His Phe Lys Pro Lys Gl - #u Glu Leu Gly Val Thr Val 35 - # 40 - # 45 - # 50 - - Tyr Gln Ser Pro His Ser Gly Ser Phe Thr Il - #e Thr Gly Asn Asn Ser Asn 55 - # 60 - # 65 - - Phe Ala Gln Arg Phe Gln Gly Ile Tyr Arg Cy - #s Phe Ala Ser Asn Lys Leu 70 - # 75 - # 80 - # 85

- - Gly Thr Ala Met Ser His Glu Ile Arg Leu Me - #t 90 - # 95 - - - - (2) INFORMATION FOR SEQ ID NO: 22: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 106 (B) TYPE: amino acid (C) STRANDEDNESS: sing - #le (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: amino acids - - (iii) HYPOTHETICAL: irrelevant - - (iv) ANTI-SENSE: no - - (vi) ORIGINAL SOURCE: (A) ORGANISM: Homo - #Sapiens (B) INDIVIDUAL ISOLATE: - # 17-18 week fetus - - (vii) IMMEDIATE SOURCE: (A) LIBRARY: Stratagen - #e cDNA Library 936206 (B) CLONE: synthesis - #of 4 clones - - (x) PUBLICATION INFORMATION: (A) AUTHORS: Hlavin, - #Mary Louise Lemmon, V - #ance (B) TITLE: Mol - #ecular structure and functional testing o - #f human L1CAM: an interspecies comparison. (C) JOURNAL: GENOMICS (D) VOLUME: 11 (E) ISSUE: (F) PAGES: 416 - #-423 (G) DATE: - # 1991 - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO: - # 22: - - Ala Glu Gly Ala Pro Lys Trp Pro Lys Glu Th - #r Val Lys Pro Val Glu Val 1 5 - # 10 - # 15 - - Glu Glu Gly Glu Ser Val Val Leu Pro Cys As - #n Pro Pro Pro Ser Ala Glu 20 - # 25 - # 30 - - Pro Leu Arg Ile Tyr Trp Met Asn Ser Lys Il - #e Leu His Ile Lys Gln Asp 35 - # 40 - # 45 - # 50 - - Glu Arg Val Thr Met Gly Gln Asn Gly Asn Le - #u Tyr Phe Ala Asn Val Leu 55 - # 60 - # 65 - - Thr Ser Asp Asn His Ser Asp Tyr Ile Cys Hi - #s Ala His Phe Pro Gly Thr 70 - # 75 - # 80 - # 85 - - Arg Thr Ile Ile Gln Lys Glu Pro Ile Asp Le - #u Arg Val Lys Ala Thr Asn 90 - # 95 - # 100 - - Ser Met Ile Asp 105 - - - - (2) INFORMATION FOR SEQ ID NO: 23: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 96 (B) TYPE: amino acid (C) STRANDEDNESS: sing - #le (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: amino acids - - (iii) HYPOTHETICAL: irrelevant - - (iv) ANTI-SENSE: no - - (vi) ORIGINAL SOURCE: (A) ORGANISM: Homo - #Sapiens (B) INDIVIDUAL ISOLATE: - # 17-18 week fetus - - (vii) IMMEDIATE SOURCE: (A) LIBRARY: Stratagen - #e cDNA Library 936206 (B) CLONE: synthesis - #of 4 clones - - (x) PUBLICATION INFORMATION: (A) AUTHORS: Hlavin, - #Mary Louise Lemmon, V - #ance (B) TITLE: Mol - #ecular structure and functional testing o - #f human L1CAM: an interspecies comparison. (C) JOURNAL: GENOMICS (D) VOLUME: 11 (E) ISSUE: (F) PAGES: 416 - #-423 (G) DATE: - #1991 - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO: - # 23: - - Arg Lys Pro Arg Leu Leu Phe Pro Thr Asn Se - #r Ser Ser His Leu Val Ala 1 5 - # 10 - # 15 - - Leu Gln Gly Gln Pro Leu Val Leu Glu Cys Il - #e Ala Glu Gly Phe Pro Thr 20 - # 25 - # 30 - - Pro Thr Ile Lys Trp Leu Arg Pro Ser Gly Pr - #o Met Pro Ala Asp Arg Val 35 - # 40 - # 45 - # 50 - - Thr Tyr Gln Asn His Asn Lys Thr Leu Gln Le - #u Leu Lys Val Gly Glu Glu 55 - # 60 - # 65 - - Asp Asp Gly Glu Tyr Arg Cys Leu Ala Glu As - #n Ser Leu Gly Ser Ala Arg 70 - # 75 - # 80 - # 85 - - His Ala Tyr Tyr Val Thr Val Glu Ala Ala Pr - #o 90 - # 95 - - - - (2) INFORMATION FOR SEQ ID NO: 24: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 92 (B) TYPE: amino acid (C) STRANDEDNESS: sing - #le (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: amino acids - - (iii) HYPOTHETICAL: irrelevant - - (iv) ANTI-SENSE: no - - (vi) ORIGINAL SOURCE: (A) ORGANISM: Homo - #Sapiens (B) INDIVIDUAL ISOLATE: - # 17-18 week fetus - - (vii) IMMEDIATE SOURCE: (A) LIBRARY: Stratagen - #e cDNA Library 936206 (B) CLONE: synthesis - #of 4 clones - - (x) PUBLICATION INFORMATION: (A) AUTHORS: Hlavin, - #Mary Louise Lemmon, V - #ance (B) TITLE: Mol - #ecular structure and functional testing o - #f human L1CAM: an interspecies comparison. (C) JOURNAL: GENOMICS (D) VOLUME: 11 (E) ISSUE: (F) PAGES: 416 - #-423 (G) DATE: - #1991 - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO: - # 24: - - Tyr Trp Leu His Lys Pro Gln Ser His Leu Ty - #r Gly Pro Gly Glu Thr Ala 1 5 - # 10 - # 15 - - Arg Leu Asp Cys Gln Val Gln Gly Arg Pro Gl - #n Pro Glu Val Thr Trp Arg 20 - # 25 - # 30 - - Ile Asn Gly Ile Pro Val Glu Glu Leu Ala Ly - #s Asp Gln Lys Tyr Arg Ile 35 - # 40 - # 45 - # 50 - - Gln Arg Gly Ala Leu Ile Leu Ser Asn Val Gl - #n Pro Ser Asp Thr Met Val 55 - # 60 - # 65 - - Thr Gln Cys Glu Ala Arg Asn Arg His Gly Le - #u Leu Leu Ala Asn Ala Tyr 70 - # 75 - # 80 - # 85 - - Ile Tyr Val Val Gln Leu Pro 90 - - - - (2) INFORMATION FOR SEQ ID NO: 25: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 93 (B) TYPE: amino acid (C) STRANDEDNESS: sing - #le (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: amino acids - - (iii) HYPOTHETICAL: irrelevant - - (iv) ANTI-SENSE: no - - (vi) ORIGINAL SOURCE: (A) ORGANISM: Homo - #Sapiens (B) INDIVIDUAL ISOLATE: - # 17-18 week fetus - - (vii) IMMEDIATE SOURCE: (A) LIBRARY: Stratagen - #e cDNA Library 936206 (B) CLONE: synthesis - #of 4 clones - - (x) PUBLICATION INFORMATION: (A) AUTHORS: Hlavin, - #Mary Louise Lemmon, V - #ance (B) TITLE: Mol - #ecular structure and functional testing o - #f human L1CAM: an interspecies comparison. (C) JOURNAL: GENOMICS (D) VOLUME: 11 (E) ISSUE: (F) PAGES: 416 - #-423 (G) DATE: - #1991 - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO: - # 25: - - Ala Lys Ile Leu Thr Ala Asp Asn Gln Thr Ty - #r Met Ala Val Gln Gly Ser 1 5 - # 10 - # 15 - - Thr Ala Tyr Leu Leu Cys Lys Ala Phe Gly Al - #a Pro Val Pro Ser Val Gln 20 - # 25 - # 30 - - Trp Leu Asp Glu Asp Gly Thr Thr Val Leu Gl - #n Asp Glu Arg Phe Phe Pro 35 - # 40 - # 45 - # 50 - - Tyr Ala Asn Gly Thr Leu Gly Ile Arg Asp Le - #u Gln Ala Asn Asp Thr Gly 55 - # 60 - # 65 - - Arg Tyr Phe Cys Leu Ala Ala Asn Asp Gln As - #n Asn Val Thr Ile Met Ala 70 - # 75 - # 80 - # 85 - - Asn Leu Lys Val Lys Asp Ala Thr 90 - - - - (2) INFORMATION FOR SEQ ID NO: 26: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 96 (B) TYPE: amino acid (C) STRANDEDNESS: sing - #le (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: amino acids - - (iii) HYPOTHETICAL: irrelevant - - (iv) ANTI-SENSE: no - - (vi) ORIGINAL SOURCE: (A) ORGANISM: Homo - #Sapiens (B) INDIVIDUAL ISOLATE: - # 17-18 week fetus - - (vii) IMMEDIATE SOURCE: (A) LIBRARY: Stratagen - #e cDNA Library 936206 (B) CLONE: synthesis - #of 4 clones - - (x) PUBLICATION INFORMATION: (A) AUTHORS: Hlavin, - #Mary Louise Lemmon, V - #ance (B) TITLE: Mol - #ecular structure and functional testing o - #f human L1CAM: an interspecies comparison. (C) JOURNAL: GENOMICS (D) VOLUME: 11 (E) ISSUE: (F) PAGES: 416 - #-423 (G) DATE: - #1991 - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO: - # 26: - - Gln Ile Thr Gln Gly Pro Arg Ser Thr Ile Gl - #u Lys Lys Gly Ser Arg Val 1 5 - # 10 - # 15 - - Thr Phe Thr Cys Gln Ala Ser Phe Asp Pro Se - #r Leu Gln Pro Ser Ile Thr 20 - # 25 - # 30 - - Trp Arg Gly Asp Gly Arg Asp Leu Gln Glu Le - #u Gly Asp Ser Asp Lys Tyr 35 - # 40 - # 45 - # 50 - - Phe Ile Glu Asp Gly Arg Leu Val Ile His Se - #r Leu Asp Tyr Ser Asp Gln 55 - # 60 - # 65 - - Gly Asn Tyr Ser Cys Val Ala Ser Thr Glu Le - #u Asp Val Val Glu Ser Arg 70 - # 75 - # 80 - # 85 - - Ala Gln Leu Leu Val Val Gly Ser Pro Gly Pr - #o 90 - # 95 - - - - (2) INFORMATION FOR SEQ ID NO: 27: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 101 (B) TYPE: amino acid (C) STRANDEDNESS: sing - #le (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: amino acids - - (iii) HYPOTHETICAL: irrelevant - - (iv) ANTI-SENSE: no - - (vi) ORIGINAL SOURCE: (A) ORGANISM: Homo - #Sapiens (B) INDIVIDUAL ISOLATE: - # 17-18 week fetus - - (vii) IMMEDIATE SOURCE:

(A) LIBRARY: Stratagen - #e cDNA Library 936206 (B) CLONE: synthesis - #of 4 clones - - (x) PUBLICATION INFORMATION: (A) AUTHORS: Hlavin, - #Mary Louise Lemmon, V - #ance (B) TITLE: Mol - #ecular structure and functional testing o - #f human L1CAM: an interspecies comparison. (C) JOURNAL: GENOMICS (D) VOLUME: 11 (E) ISSUE: (F) PAGES: 416 - #-423 (G) DATE: - #1991 - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO: - # 27: - - Val Pro Arg Leu Val Leu Ser Asp Leu His Le - #u Leu Thr Gln Ser Gln Val 1 5 - # 10 - # 15 - - Arg Val Ser Trp Ser Pro Ala Glu Asp His As - #n Ala Pro Ile Glu Lys Tyr 20 - # 25 - # 30 - - Asp Ile Glu Phe Glu Asp Lys Glu Met Ala Pr - #o Glu Lys Trp Tyr Ser Leu 35 - # 40 - # 45 - # 50 - - Gly Lys Val Pro Gly Asn Gln Thr Ser Thr Th - #r Leu Lys Leu Ser Pro Tyr 55 - # 60 - # 65 - - Val His Tyr Thr Phe Arg Val Thr Ala Ile As - #n Lys Tyr Gly Pro Gly Glu 70 - # 75 - # 80 - # 85 - - Pro Ser Pro Val Ser Glu Thr Val Val Thr Pr - #o Glu Ala Ala Pro Glu 90 - # 95 - # 100 - - - - (2) INFORMATION FOR SEQ ID NO: 28: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 96 (B) TYPE: amino acid (C) STRANDEDNESS: sing - #le (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: amino acids - - (iii) HYPOTHETICAL: irrelevant - - (iv) ANTI-SENSE: no - - (vi) ORIGINAL SOURCE: (A) ORGANISM: Homo - #Sapiens (B) INDIVIDUAL ISOLATE: - # 17-18 week fetus - - (vii) IMMEDIATE SOURCE: (A) LIBRARY: Stratagen - #e cDNA Library 936206 (B) CLONE: synthesis - #of 4 clones - - (x) PUBLICATION INFORMATION: (A) AUTHORS: Hlavin, - #Mary Louise Lemmon, V - #ance (B) TITLE: Mol - #ecular structure and functional testing o - #f human L1CAM: an interspecies comparison. (C) JOURNAL: GENOMICS (D) VOLUME: 11 (E) ISSUE: (F) PAGES: 416 - #-423 (G) DATE: - #1991 - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO: - # 28: - - Lys Asn Pro Val Asp Val Lys Gly Glu Gly As - #n Glu Thr Thr Asn Met Val 1 5 - # 10 - # 15 - - Ile Thr Trp Lys Pro Leu Arg Trp Met Asp Tr - #p Asn Ala Pro Gln Val Gln 20 - # 25 - # 30 - - Tyr Arg Val Gln Trp Arg Pro Gln Gly Thr Ar - #g Gly Pro Trp Gln Glu Gln 35 - # 40 - # 45 - # 50 - - Ile Val Ser Asp Pro Phe Leu Val Val Ser As - #n Thr Ser Thr Phe Val Pro 55 - # 60 - # 65 - - Tyr Glu Ile Lys Val Gln Ala Val Asn Ser Gl - #n Gly Lys Gly Pro Glu Pro 70 - # 75 - # 80 - # 85 - - Gln Val Thr Ile Gly Tyr Ser Gly Glu Asp Ty - #r 90 - # 95 - - - - (2) INFORMATION FOR SEQ ID NO: 29: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 106 (B) TYPE: amino acid (C) STRANDEDNESS: sing - #le (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: amino acids - - (iii) HYPOTHETICAL: irrelevant - - (iv) ANTI-SENSE: no - - (vi) ORIGINAL SOURCE: (A) ORGANISM: Homo - #Sapiens (B) INDIVIDUAL ISOLATE: - # 17-18 week fetus - - (vii) IMMEDIATE SOURCE: (A) LIBRARY: Stratagen - #e cDNA Library 936206 (B) CLONE: synthesis - #of 4 clones - - (x) PUBLICATION INFORMATION: (A) AUTHORS: Hlavin, - #Mary Louise Lemmon, V - #ance (B) TITLE: Mol - #ecular structure and functional testing o - #f human L1CAM: an interspecies comparison. (C) JOURNAL: GENOMICS (D) VOLUME: 11 (E) ISSUE: (F) PAGES: 416 - #-423 (G) DATE: - #1991 - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO: - # 29: - - Pro Gln Ala Ile Pro Glu Leu Glu Gly Ile Gl - #u Ile Leu Asn Ser Ser Ala 1 5 - # 10 - # 15 - - Val Leu Val Lys Trp Arg Pro Val Asp Leu Al - #a Gln Val Lys Gly His Leu 20 - # 25 - # 30 - - Arg Gly Tyr Asn Val Thr Tyr Trp Arg Glu Gl - #y Ser Gln Arg Lys His Ser 35 - # 40 - # 45 - # 50 - - Lys Arg His Ile His Lys Asp His Val Val Va - #l Pro Ala Asn Thr Thr Ser 55 - # 60 - # 65 - - Val Ile Leu Ser Gly Leu Arg Pro Tyr Ser Se - #r Tyr His Leu Glu Val Gln 70 - # 75 - # 80 - # 85 - - Ala Phe Asn Gly Arg Gly Ser Gly Pro Ala Se - #r Glu Phe Thr Phe Ser Thr 90 - # 95 - # 100 - - Pro Glu Gly Val 105 - - - - (2) INFORMATION FOR SEQ ID NO: 30: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 97 (B) TYPE: amino acid (C) STRANDEDNESS: sing - #le (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: amino acids - - (iii) HYPOTHETICAL: irrelevant - - (iv) ANTI-SENSE: no - - (vi) ORIGINAL SOURCE: (A) ORGANISM: Homo - #Sapiens (B) INDIVIDUAL ISOLATE: - # 17-18 week fetus - - (vii) IMMEDIATE SOURCE: (A) LIBRARY: Stratagen - #e cDNA Library 936206 (B) CLONE: synthesis - #of 4 clones - - (x) PUBLICATION INFORMATION: (A) AUTHORS: Hlavin, - #Mary Louise Lemmon, V - #ance (B) TITLE: Mol - #ecular structure and functional testing o - #f human L1CAM: an interspecies comparison. (C) JOURNAL: GENOMICS (D) VOLUME: 11 (E) ISSUE: (F) PAGES: 416 - #-423 (G) DATE: - #1991 - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO: - # 30: - - Pro Gly His Pro Glu Ala Leu His Leu Glu Cy - #s Gln Ser Asn Thr Ser Leu 1 5 - # 10 - # 15 - - Leu Leu Arg Trp Gln Pro Pro Leu Ser His As - #n Gly Val Leu Thr Gly Tyr 20 - # 25 - # 30 - - Val Leu Ser Tyr His Pro Leu Asp Glu Gly Gl - #y Lys Gly Gln Leu Ser Phe 35 - # 40 - # 45 - # 50 - - Asn Leu Arg Asp Pro Glu Leu Arg Thr His As - #n Leu Thr Asp Leu Ser Pro 55 - # 60 - # 65 - - His Leu Arg Tyr Arg Phe Gln Leu Gln Ala Th - #r Thr Lys Glu Gly Pro Gly 70 - # 75 - # 80 - # 85 - - Glu Ala Ile Val Arg Glu Gly Gly Thr Met Al - #a Leu 90 - # 95 - - - - (2) INFORMATION FOR SEQ ID NO: 31: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 99 (B) TYPE: amino acid (C) STRANDEDNESS: sing - #le (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: amino acids - - (iii) HYPOTHETICAL: irrelevant - - (iv) ANTI-SENSE: no - - (vi) ORIGINAL SOURCE: (A) ORGANISM: Homo - #Sapiens (B) INDIVIDUAL ISOLATE: - # 17-18 week fetus - - (vii) IMMEDIATE SOURCE: (A) LIBRARY: Stratagen - #e cDNA Library 936206 (B) CLONE: synthesis - #of 4 clones - - (x) PUBLICATION INFORMATION: (A) AUTHORS: Hlavin, - #Mary Louise Lemmon, V - #ance (B) TITLE: Mol - #ecular structure and functional testing o - #f human L1CAM: an interspecies comparison. (C) JOURNAL: GENOMICS (D) VOLUME: 11 (E) ISSUE: (F) PAGES: 416 - #-423 (G) DATE: - #1991 - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO: - # 31: - - Ser Gly Ile Ser Asp Phe Gly Asn Ile Ser Al - #a Thr Ala Gly Glu Asn Tyr 1 5 - # 10 - # 15 - - Ser Val Val Ser Trp Val Pro Lys Glu Gly Gl - #n Cys Asn Phe Arg Phe His 20 - # 25 - # 30 - - Ile Leu Phe Lys Ala Leu Gly Glu Glu Lys Gl - #y Gly Ala Ser Leu Ser Pro 35 - # 40 - # 45 - # 50 - - Gln Tyr Val Ser Tyr Asn Gln Ser Ser Tyr Th - #r Gln Trp Asp Leu Gln Pro 55 - # 60 - # 65 - - Asp Thr Asp Tyr Glu Ile His Leu Phe Lys Gl - #u Arg Met Phe Arg His Gln 70 - # 75 - # 80 - # 85 - - Met Ala Val Lys Thr Asn Gly Thr Gly Arg Va - #l Arg Leu Pro 90 - # 95 - - - - (2) INFORMATION FOR SEQ ID NO: 32: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 144 (B) TYPE: amino acid (C) STRANDEDNESS: sing - #le (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: amino acids - - (iii) HYPOTHETICAL: irrelevant - - (iv) ANTI-SENSE: no - - (vi) ORIGINAL SOURCE: (A) ORGANISM: Homo - #Sapiens (B) INDIVIDUAL ISOLATE: - # 17-18 week fetus - - (vii) IMMEDIATE SOURCE: (A) LIBRARY: Stratagen - #e cDNA Library 936206 (B) CLONE: synthesis - #of 4 clones - - (x) PUBLICATION INFORMATION: (A) AUTHORS: Hlavin, - #Mary Louise Lemmon, V - #ance (B) TITLE: Mol - #ecular structure and functional testing o - #f human L1CAM: an interspecies comparison. (C) JOURNAL: GENOMICS (D) VOLUME: 11 (E) ISSUE: (F) PAGES: 416 - #-423 (G) DATE: - #1991 - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO: - # 32: - - Pro Ala Gly Phe Ala Thr Glu Gly Trp Phe Il - #e Gly Phe Val Ser Ala Ile 1 5 - # 10 - # 15 - - Ile Leu Leu Leu Leu Val Leu Leu Ile Leu Cy - #s Phe Ile Lys Arg Ser Lys 20 - # 25 - # 30 - - Gly Gly Lys Tyr Ser Val Lys Asp Lys Glu As - #p Thr Gln Val Asp Ser Glu 35 - # 40 - # 45 - # 50

- - Ala Arg Pro Met Lys Asp Glu Thr Phe Gly Gl - #u Tyr Arg Ser Leu Glu Ser 55 - # 60 - # 65 - - Asp Asn Glu Glu Lys Ala Phe Gly Ser Ser Gl - #n Pro Ser Leu Asn Gly Asp 70 - # 75 - # 80 - # 85 - - Ile Lys Pro Leu Gly Ser Asp Asp Ser Leu Al - #a Asp Tyr Gly Gly Ser Val 90 - # 95 - # 100 - - Asp Val Gln Phe Asn Glu Asp Gly Ser Phe Il - #e Gly Gln Tyr Ser Gly Lys 105 - # 110 - # 115 - - Lys Glu Lys Glu Ala Ala Gly Gly Asn Asp Se - #r Ser Gly Ala Thr Ser Pro 120 1 - #25 1 - #30 1 - #35 - - Ile Asn Pro Ala Val Ala Leu Glu 140 - - - - (2) INFORMATION FOR SEQ ID NO: 33: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 90 (B) TYPE: amino acid (C) STRANDEDNESS: sing - #le (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: amino acids - - (iii) HYPOTHETICAL: irrelevant - - (iv) ANTI-SENSE: no - - (vi) ORIGINAL SOURCE: (A) ORGANISM: CHICKEN (B) INDIVIDUAL ISOLATE: - # e9-e14 embryos brains, adult brains - - (vii) IMMEDIATE SOURCE: (A) LIBRARY: many l - #ambda GT11 cDNA and genomic libraries (B) CLONE: synthesis - #of 14 clones - - (x) PUBLICATION INFORMATION: (A) AUTHORS: Burgoon, - #M.P. Grumet, M - #. Mauro, V. Edelman, - #G.M. Cunningham, - #B.A. (B) TITLE: Structu - #re of the chicken neuron- glial cel - #l adhesion molecule, Ng-CAM: Origin of - # the polypeptides and relation - #to the Ig superfamily. (C) JOURNAL: J. Cel - #l Biol. (D) VOLUME: 112 (E) ISSUE: (F) PAGES: 101 - #7-1029 (G) DATE: - #1991 - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO: - # 33: - - Glu Leu Thr Glu Glu Pro Pro Glu Gln Leu Va - #l Val Phe Pro Ser Asp Asp 1 5 - # 10 - # 15 - - Ile Val Leu Lys Cys Val Ala Thr Gly Asn Pr - #o Pro Val Gln Tyr Arg Trp 20 - # 25 - # 30 - - Ser Arg Glu Ile Ser Pro Ser Ser Pro Arg Se - #r Thr Gly Gly Ser Arg Trp 35 - # 40 - # 45 - # 50 - - Ser Pro Asp Arg His Leu Val Ile Asn Ala Th - #r Leu Ala Ala Arg Leu Gln 55 - # 60 - # 65 - - Gly Arg Phe Arg Cys Phe Ala Thr Asn Ala Le - #u Gly Thr Ala Val Ser Pro 70 - # 75 - # 80 - # 85 - - Glu Ala Asn Val Ile 90 - - - - (2) INFORMATION FOR SEQ ID NO: 34: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 106 (B) TYPE: amino acid (C) STRANDEDNESS: sing - #le (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: amino acids - - (iii) HYPOTHETICAL: irrelevant - - (iv) ANTI-SENSE: no - - (vi) ORIGINAL SOURCE: (A) ORGANISM: CHICKEN (B) INDIVIDUAL ISOLATE: - # e9-e14 embryos brains, adult brains - - (vii) IMMEDIATE SOURCE: (A) LIBRARY: many l - #ambda GT11 cDNA and genomic libraries (B) CLONE: synthesis - #of 14 clones - - (x) PUBLICATION INFORMATION: (A) AUTHORS: Burgoon, - #M.P. Grumet, M - #. Mauro, V. Edelman, - #G.M. Cunningham, - #B.A. (B) TITLE: Str - #ucture of the chicken neuron- glial cel - #l adhesion molecule, Ng-CAM: Origin of - # the polypeptides and relation - #to the Ig superfamily. (C) JOURNAL: J. Cel - #l Biol. (D) VOLUME: 112 (E) ISSUE: (F) PAGES: 101 - #7-1029 (G) DATE: - #1991 - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO: - # 34: - - Ala Glu Asn Thr Pro Gln Trp Pro Lys Lys Ly - #s Val Thr Pro Val Glu Val 1 5 - # 10 - # 15 - - Glu Glu Gly Asp Pro Val Val Leu Pro Cys As - #p Pro Pro Glu Ser Ala Val 20 - # 25 - # 30 - - Pro Pro Lys Ile Tyr Trp Leu Asn Ser Asp Il - #e Val His Ile Ala Gln Asp 35 - # 40 - # 45 - # 50 - - Glu Arg Val Ser Met Gly Gln Asp Gly Asn Le - #u Tyr Phe Ser Asn Ala Met 55 - # 60 - # 65 - - Val Gly Asp Ser His Pro Asp Tyr Ile Cys Hi - #s Ala His Phe Leu Gly Pro 70 - # 75 - # 80 - # 85 - - Arg Thr Ile Ile Gln Lys Glu Pro Leu Asp Le - #u Arg Val Ala Pro Ser Asn 90 - # 95 - # 100 - - Ala Val Arg Ser 105 - - - - (2) INFORMATION FOR SEQ ID NO: 35: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 94 (B) TYPE: amino aci - #d (C) STRANDEDNESS: sing - #le (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: amino acids - - (iii) HYPOTHETICAL: irrelevant - - (iv) ANTI-SENSE: no - - (vi) ORIGINAL SOURCE: (A) ORGANISM: CHICKEN (B) INDIVIDUAL ISOLATE: - # e9-e14 embryos brains, adult brains - - (vii) IMMEDIATE SOURCE: (A) LIBRARY: many l - #ambda GT11 cDNA and genomic libraries (B) CLONE: synthesis - #of 14 clones - - (x) PUBLICATION INFORMATION: (A) AUTHORS: Burgoon, - #M.P. Grumet, M - #. Mauro, V. Edelman, - #G.M. Cunningham, - #B.A. (B) TITLE: Str - #ucture of the chicken neuron- glial cel - #l adhesion molecule, Ng-CAM: Origin of - # the polypeptides and relation - #to the Ig superfamily. (C) JOURNAL: J. Cel - #l Biol. (D) VOLUME: 112 (E) ISSUE: (F) PAGES: 101 - #7-1029 (G) DATE: - #1991 - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO: - # 35: - - Arg Arg Pro Arg Leu Leu Leu Pro Arg Asp Pr - #o Gln Thr Thr Thr Ile Ala 1 5 - # 10 - # 15 - - Leu Arg Gly Gly Ser Val Val Leu Glu Cys Il - #e Ala Glu Gly Leu Pro Thr 20 - # 25 - # 30 - - Pro Trp Val Arg Trp Arg Arg Leu Asn Gly Pr - #o Leu Leu Pro Gly Gly Val 35 - # 40 - # 45 - # 50 - - Gly Asn Phe Asn Lys Thr Leu Arg Leu Trp Gl - #y Val Thr Glu Ser Asp Asp 55 - # 60 - # 65 - - Gly Glu Tyr Glu Cys Val Ala Glu Asn Gly Ar - #g Gly Thr Ala Arg Gly Thr 70 - # 75 - # 80 - # 85 - - His Ser Val Thr Val Glu Ala Ala Pro 90 - - - - (2) INFORMATION FOR SEQ ID NO: 36: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 91 (B) TYPE: amino acid (C) STRANDEDNESS: sing - #le (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: amino acids - - (iii) HYPOTHETICAL: irrelevant - - (iv) ANTI-SENSE: no - - (vi) ORIGINAL SOURCE: (A) ORGANISM: CHICKEN (B) INDIVIDUAL ISOLATE: - # e9-e14 embryos brains, adult brains - - (vii) IMMEDIATE SOURCE: (A) LIBRARY: many l - #ambda GT11 cDNA and genomic libraries (B) CLONE: synthesis - #of 14 clones - - (x) PUBLICATION INFORMATION: (A) AUTHORS: Burgoon, - #M.P. Grumet, M - #. Mauro, V. Edelman, - #G.M. Cunningham, - #B.A. (B) TITLE: Str - #ucture of the chicken neuron- glial cel - #l adhesion molecule, Ng-CAM: Origin of - # the polypeptides and relation - #to the Ig superfamily. (C) JOURNAL: J. Cel - #l Biol. (D) VOLUME: 112 (E) ISSUE: (F) PAGES: 101 - #7-1029 (G) DATE: - #1991 - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO: - # 36: - - Tyr Trp Val Arg Arg Pro Gln Ser Gly Val Ph - #e Gly Pro Gly Glu Thr Ala 1 5 - # 10 - # 15 - - Arg Leu Asp Cys Glu Val Gly Gly Lys Pro Ar - #g Pro Gln Ile Gln Trp Ser 20 - # 25 - # 30 - - Ile Asn Gly Val Pro Ile Glu Ala Ala Gly Al - #a Glu Arg Arg Trp Leu Arg 35 - # 40 - # 45 - # 50 - - Gly Gly Ala Leu Val Leu Pro Glu Leu Arg Pr - #o Asn Asp Ser Ala Val Leu 55 - # 60 - # 65 - - Gln Cys Glu Ala Arg Asn Arg His Gly Pro Le - #u Leu Ala Asn Ala Phe Leu 70 - # 75 - # 80 - # 85 - - His Val Val Glu Leu Pro 90 - - - - (2) INFORMATION FOR SEQ ID NO: 37: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 93 (B) TYPE: amino acid (C) STRANDEDNESS: sing - #le (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: amino acids - - (iii) HYPOTHETICAL: irrelevant - - (iv) ANTI-SENSE: no - - (vi) ORIGINAL SOURCE: (A) ORGANISM: CHICKEN (B) INDIVIDUAL ISOLATE: - # e9-e14 embryos brains, adult brains - - (vii) IMMEDIATE SOURCE: (A) LIBRARY: many l - #ambda GT11 cDNA and genomic libraries (B) CLONE: synthesis - #of 14 clones - - (x) PUBLICATION INFORMATION: (A) AUTHORS: Burgoon, - #M.P. Grumet, M - #. Mauro, V. Edelman, - #G.M.

Cunningham, - #B.A. (B) TITLE: Str - #ucture of the chicken neuron- glial cel - #l adhesion molecule, Ng-CAM: Origin of - # the polypeptides and relation - #to the Ig superfamily. (C) JOURNAL: J. Cel - #l Biol. (D) VOLUME: 112 (E) ISSUE: (F) PAGES: 101 - #7-1029 (G) DATE: - #1991 - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO: - # 37: - - Leu Arg Met Leu Thr Ala Asp Glu Gln Arg Ty - #r Glu Val Val Glu Asn Gln 1 5 - # 10 - # 15 - - Thr Val Phe Leu His Cys Arg Thr Phe Gly Al - #a Pro Ala Pro Asn Val Glu 20 - # 25 - # 30 - - Trp Leu Thr Pro Thr Leu Glu Pro Ala Leu Gl - #n Asp Asp Arg Ser Phe Val 35 - # 40 - # 45 - # 50 - - Phe Thr Asn Gly Ser Leu Arg Val Ser Ala Va - #l Arg Gly Gly Asp Gly Gly 55 - # 60 - # 65 - - Val Tyr Thr Cys Met Ala Gln Asn Ala His Se - #r Asn Gly Ser Leu Thr Ala 70 - # 75 - # 80 - # 85 - - Leu Leu Glu Val Arg Ala Pro Thr 90 - - - - (2) INFORMATION FOR SEQ ID NO: 38: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 92 (B) TYPE: amino acid (C) STRANDEDNESS: sing - #le (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: amino acids - - (iii) HYPOTHETICAL: irrelevant - - (iv) ANTI-SENSE: no - - (vi) ORIGINAL SOURCE: (A) ORGANISM: CHICKEN (B) INDIVIDUAL ISOLATE: - # e9-e14 embryos brains, adult brains - - (vii) IMMEDIATE SOURCE: (A) LIBRARY: many l - #ambda GT11 cDNA and genomic libraries (B) CLONE: synthesis - #of 14 clones - - (x) PUBLICATION INFORMATION: (A) AUTHORS: Burgoon, - #M.P. Grumet, M - #. Mauro, V. Edelman, - #G.M. Cunningham, - #B.A. (B) TITLE: Str - #ucture of the chicken neuron- glial cel - #l adhesion molecule, Ng-CAM: Origin of - # the polypeptides and relation - #to the Ig superfamily. (C) JOURNAL: J. Cel - #l Biol. (D) VOLUME: 112 (E) ISSUE: (F) PAGES: 101 - #7-1029 (G) DATE: - #1991 - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO: - # 38: - - Arg Ile Ser Ala Pro Pro Arg Ser Ala Thr Al - #a Lys Lys Gly Glu Thr Val 1 5 - # 10 - # 15 - - Thr Phe His Cys Gly Ala Thr Phe Asp Pro Al - #a Val Thr Pro Gly Glu Leu 20 - # 25 - # 30 - - Arg Trp Leu Arg Gly Gly Gln Pro Leu Pro As - #p Asp Pro Arg Tyr Ser Val 35 - # 40 - # 45 - # 50 - - Ala Ala Glu Met Thr Val Ser Asn Val Asp Ty - #r Gly Asp Glu Gly Thr Ile 55 - # 60 - # 65 - - Gln Cys Arg Ala Ser Thr Pro Leu Asp Ser Al - #a Glu Ala Glu Ala Gln Leu 70 - # 75 - # 80 - # 85 - - Arg Val Val Gly Arg Pro Pro 90 - - - - (2) INFORMATION FOR SEQ ID NO: 39: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 98 (B) TYPE: amino acid (C) STRANDEDNESS: sing - #le (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: amino acids - - (iii) HYPOTHETICAL: irrelevant - - (iv) ANTI-SENSE: no - - (vi) ORIGINAL SOURCE: (A) ORGANISM: CHICKEN (B) INDIVIDUAL ISOLATE: - # e9-e14 embryos brains, adult brains - - (vii) IMMEDIATE SOURCE: (A) LIBRARY: many l - #ambda GT11 cDNA and genomic libraries (B) CLONE: synthesis - #of 14 clones - - (x) PUBLICATION INFORMATION: (A) AUTHORS: Burgoon, - #M.P. Grumet, M - #. Mauro, V. Edelman, - #G.M. Cunningham, - #B.A. (B) TITLE: Str - #ucture of the chicken neuron- glial cel - #l adhesion molecule, Ng-CAM: Origin of - # the polypeptides and relation - #to the Ig superfamily. (C) JOURNAL: J. Cel - #l Biol. (D) VOLUME: 112 (E) ISSUE: (F) PAGES: 101 - #7-1029 (G) DATE: - #1991 - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO: - # 39: - - Ser Arg Asp Leu Gln Val Met Glu Val Asp Gl - #u His Arg Val Arg Leu Ser 1 5 - # 10 - # 15 - - Trp Thr Pro Gly Asp Asp His Asn Ser Pro Il - #e Glu Lys Phe Val Val Glu 20 - # 25 - # 30 - - Glu Glu Glu Glu Arg Glu Asp Leu Gln Arg Gl - #y Phe Gly Ala Ala Asp Val 35 - # 40 - # 45 - # 50 - - Pro Gly Gln Pro Trp Thr Pro Pro Leu Pro Le - #u Ser Pro Tyr Gly Arg Phe 55 - # 60 - # 65 - - Pro Phe Arg Val Val Ala Val Asn Ala Tyr Gl - #y Arg Gly Glu His His Ala 70 - # 75 - # 80 - # 85 - - Pro Ser Ala Pro Ile Glu Thr Pro Pro Ala Al - #a Pro Glu 90 - # 95 - - - - (2) INFORMATION FOR SEQ ID NO: 40: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 104 (B) TYPE: amino acid (C) STRANDEDNESS: sing - #le (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: amino acids - - (iii) HYPOTHETICAL: irrelevant - - (iv) ANTI-SENSE: no - - (vi) ORIGINAL SOURCE: (A) ORGANISM: CHICKEN (B) INDIVIDUAL ISOLATE: - # e9-e14 embryos brains, adult brains - - (vii) IMMEDIATE SOURCE: (A) LIBRARY: many l - #ambda GT11 cDNA and genomic libraries (B) CLONE: synthesis - #of 14 clones - - (x) PUBLICATION INFORMATION: (A) AUTHORS: Burgoon, - #M.P. Grumet, M - #. Mauro, V. Edelman, - #G.M. Cunningham, - #B.A. (B) TITLE: Str - #ucture of the chicken neuron- glial cel - #l adhesion molecule, Ng-CAM: Origin of - # the polypeptides and relation - #to the Ig superfamily. (C) JOURNAL: J. Cel - #l Biol. (D) VOLUME: 112 (E) ISSUE: (F) PAGES: 101 - #7-1029 (G) DATE: - #1991 - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO: - # 40: - - Arg Asn Pro Gly Gly Val His Gly Glu Gly As - #n Glu Thr Gly Asn Leu Val 1 5 - # 10 - # 15 - - Ile Thr Trp Glu Pro Leu Pro Pro Gln Ala Tr - #p Asn Ala Pro Trp Ala Arg 20 - # 25 - # 30 - - Tyr Arg Val Gln Trp Arg Pro Leu Glu Glu Pr - #o Gly Gly Gly Gly Pro Ser 35 - # 40 - # 45 - # 50 - - Gly Gly Phe Pro Trp Ala Glu Ser Thr Val As - #p Ala Pro Pro Val Val Val 55 - # 60 - # 65 - - Gly Gly Leu Pro Pro Phe Ser Pro Phe Gln Il - #e Arg Val Gln Ala Val Asn 70 - # 75 - # 80 - # 85 - - Gly Ala Gly Lys Gly Pro Glu Ala Thr Pro Gl - #y Val Gly His Ser Gly Glu 90 - # 95 - # 100 - - Asp Leu - - - - (2) INFORMATION FOR SEQ ID NO: 41: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 126 (B) TYPE: amino acid (C) STRANDEDNESS: sing - #le (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: amino acids - - (iii) HYPOTHETICAL: irrelevant - - (iv) ANTI-SENSE: no - - (vi) ORIGINAL SOURCE: (A) ORGANISM: CHICKEN (B) INDIVIDUAL ISOLATE: - # e9-e14 embryos brains, adult brains - - (vii) IMMEDIATE SOURCE: (A) LIBRARY: many l - #ambda GT11 cDNA and genomic libraries (B) CLONE: synthesis - #of 14 clones - - (x) PUBLICATION INFORMATION: (A) AUTHORS: Burgoon, - #M.P. Grumet, M - #. Mauro, V. Edelman, - #G.M. Cunningham, - #B.A. (B) TITLE: Str - #ucture of the chicken neuron- glial cel - #l adhesion molecule, Ng-CAM: Origin of - # the polypeptides and relation - #to the Ig superfamily. (C) JOURNAL: J. Cel - #l Biol. (D) VOLUME: 112 (E) ISSUE: (F) PAGES: 101 - #7-1029 (G) DATE: - #1991 - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO: - # 41: - - Pro Leu Val Tyr Pro Glu Asn Val Gly Val Gl - #u Leu Leu Asn Ser Ser Thr 1 5 - # 10 - # 15 - - Val Arg Val Arg Trp Thr Leu Gly Gly Gly Pr - #o Lys Glu Leu Arg Gly Arg 20 - # 25 - # 30 - - Leu Arg Gly Phe Arg Val Leu Tyr Trp Arg Le - #u Gly Trp Val Gly Glu Arg 35 - # 40 - # 45 - # 50 - - Ser Arg Arg Gln Ala Pro Pro Asp Pro Pro Gl - #n Ile Pro Gln Ser Pro Ala 55 - # 60 - # 65 - - Glu Asp Pro Pro Pro Phe Pro Pro Val Ala Le - #u Thr Val Gly Gly Asp Ala 70 - # 75 - # 80 - # 85 - - Arg Gly Ala Leu Leu Gly Gly Leu Arg Pro Tr - #p Ser Arg Tyr Gln Leu Arg 90 - # 95 - # 100 - - Val Leu Val Phe Asn Gly Arg Gly Asp Gly Pr - #o Pro Ser Glu Pro Ile Ala 105 - # 110 - # 115 - - Phe Glu Thr Pro Glu Gly Val 120 1 - #25 - - - - (2) INFORMATION FOR SEQ ID NO: 42: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 98 (B) TYPE: amino acid (C) STRANDEDNESS: sing - #le (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: amino acids - - (iii) HYPOTHETICAL: irrelevant - - (iv) ANTI-SENSE: no - - (vi) ORIGINAL SOURCE: (A) ORGANISM: CHICKEN (B) INDIVIDUAL ISOLATE: - # e9-e14 embryos brains, adult brains - - (vii) IMMEDIATE SOURCE:

(A) LIBRARY: many l - #ambda GT11 cDNA and genomic libraries (B) CLONE: synthesis - #of 14 clones - - (x) PUBLICATION INFORMATION: (A) AUTHORS: Burgoon, - #M.P. Grumet, M - #. Mauro, V. Edelman, - #G.M. Cunningham, - #B.A. (B) TITLE: Str - #ucture of the chicken neuron- glial cel - #l adhesion molecule, Ng-CAM: Origin of - # the polypeptides and relation - #to the Ig superfamily. (C) JOURNAL: J. Cel - #l Biol. (D) VOLUME: 112 (E) ISSUE: (F) PAGES: 101 - #7-1029 (G) DATE: - #1991 - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO: - # 42: - - Pro Gly Pro Pro Glu Glu Leu Arg Val Glu Ar - #g Leu Asp Asp Thr Ala Leu 1 5 - # 10 - # 15 - - Ser Val Val Glu Arg Arg Thr Phe Lys Arg Se - #r Ile Thr Gly Tyr Val Leu 20 - # 25 - # 30 - - Arg Tyr Gln Gln Val Glu Pro Gly Ser Ala Le - #u Pro Gly Gly Ser Val Leu 35 - # 40 - # 45 - # 50 - - Arg Asp Pro Gln Cys Asp Leu Arg Gly Leu As - #n Ala Arg Ser Arg Tyr Arg 55 - # 60 - # 65 - - Leu Ala Leu Pro Ser Thr Pro Arg Glu Arg Pr - #o Ala Leu Gln Thr Val Gly 70 - # 75 - # 80 - # 85 - - Ser Thr Lys Pro Glu Pro Pro Ser Pro Leu Tr - #p Ser Arg 90 - # 95 - - - - (2) INFORMATION FOR SEQ ID NO: 43: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 93 (B) TYPE: amino acid (C) STRANDEDNESS: sing - #le (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: amino acids - - (iii) HYPOTHETICAL: irrelevant - - (iv) ANTI-SENSE: no - - (vi) ORIGINAL SOURCE: (A) ORGANISM: CHICKEN (B) INDIVIDUAL ISOLATE: - # e9-e14 embryos brains, adult brains - - (vii) IMMEDIATE SOURCE: (A) LIBRARY: many l - #ambda GT11 cDNA and genomic libraries (B) CLONE: synthesis - #of 14 clones - - (x) PUBLICATION INFORMATION: (A) AUTHORS: Burgoon, - #M.P. Grumet, M - #. Mauro, V. Edelman, - #G.M. Cunningham, - #B.A. (B) TITLE: Str - #ucture of the chicken neuron- glial cel - #l adhesion molecule, Ng-CAM: Origin of - # the polypeptides and relation - #to the Ig superfamily. (C) JOURNAL: J. Cel - #l Biol. (D) VOLUME: 112 (E) ISSUE: (F) PAGES: 101 - #7-1029 (G) DATE: - #1991 - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO: - # 43: - - Phe Gly Val Gly Gly Arg Gly Gly Phe His Gl - #y Ala Ala Val Glu Phe Gly 1 5 - # 10 - # 15 - - Ala Ala Gln Glu Asp Asp Val Glu Phe Glu Va - #l Gln Phe Met Asn Lys Ser 20 - # 25 - # 30 - - Thr Asp Glu Pro Trp Arg Thr Ser Gly Arg Al - #a Asn Ser Ser Leu Arg Arg 35 - # 40 - # 45 - # 50 - - Tyr Arg Leu Glu Gly Leu Arg Pro Gly Thr Al - #a Tyr Arg Val Gln Phe Val 55 - # 60 - # 65 - - Gly Arg Asn Arg Ser Gly Glu Asn Val Ala Ph - #e Trp Glu Ser Glu Val Gln 70 - # 75 - # 80 - # 85 - - Thr Asn Gly Thr Val Val Pro Gln 90 - - - - (2) INFORMATION FOR SEQ ID NO: 44: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 144 (B) TYPE: amino acid (C) STRANDEDNESS: sing - #le (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: amino acids - - (iii) HYPOTHETICAL: irrelevant - - (iv) ANTI-SENSE: no - - (vi) ORIGINAL SOURCE: (A) ORGANISM: CHICKEN (B) INDIVIDUAL ISOLATE: - # e9-e14 embryos brains, adult brains - - (vii) IMMEDIATE SOURCE: (A) LIBRARY: many l - #ambda GT11 cDNA and genomic libraries (B) CLONE: synthesis - #of 14 clones - - (x) PUBLICATION INFORMATION: (A) AUTHORS: Burgoon, - #M.P. Grumet, M - #. Mauro, V. Edelman, - #G.M. Cunningham, - #B.A. (B) TITLE: Str - #ucture of the chicken neuron- glial cel - #l adhesion molecule, Ng-CAM: Origin of - # the polypeptides and relation - #to the Ig superfamily. (C) JOURNAL: J. Cel - #l Biol. (D) VOLUME: 112 (E) ISSUE: (F) PAGES: 101 - #7-1029 (G) DATE: - #1991 - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO: - # 44: - - Pro Gly Gly Gly Val Cys Thr Lys Gly Trp Ph - #e Ile Gly Phe Val Ser Ser 1 5 - # 10 - # 15 - - Val Val Leu Leu Leu Leu Ile Leu Leu Ile Le - #u Cys Phe Ile Lys Arg Ser 20 - # 25 - # 30 - - Lys Gly Gly Lys Tyr Ser Val Lys Asp Lys Gl - #u Asp Thr Gln Val Asp Ser 35 - # 40 - # 45 - # 50 - - Glu Ala Arg Pro Met Lys Asp Glu Thr Phe Gl - #y Glu Tyr Arg Ser Leu Glu 55 - # 60 - # 65 - - Ser Glu Ala Glu Lys Gly Ser Ala Ser Gly Se - #r Gly Ala Gly Ser Gly Val 70 - # 75 - # 80 - # 85 - - Gly Ser Pro Gly Arg Gly Pro Cys Ala Ala Gl - #y Ser Glu Asp Ser Leu Ala 90 - # 95 - # 100 - - Gly Tyr Gly Gly Ser Gly Asp Val Gln Phe As - #n Glu Asp Gly Ser Phe Ile 105 - # 110 - # 115 - - Gly Gln Tyr Arg Gly Pro Gly Ala Gly Pro Gl - #y Ser Ser Gly Pro Ala Ser 120 1 - #25 1 - #30 1 - #35 - - Pro Cys Ala Gly Pro Pro Leu Asp 140 __________________________________________________________________________

* * * * *

---