The present invention is directed to the isolation and purification of an L1-like molecule (i.e. L1CAM) from human brain. It has been found that the isolated L1CAM molecule supports neurite growth in vitro. Applicants have also cloned and sequenced the entire coding region of human L1CAM, and found that it shows a very high degree of homology to mouse L1cam with 92% identity at the amino acid level. This similarity suggest that L1CAM is an important molecule in normal human nervous system development and nerve regeneration. Overall, there is substantially less homology to chick Ng-CAM; they are 40% identical at the amino acid level but many regions are highly conserved. Comparison of the sequences from human, mouse, chick and Drosophila, indicates that the L1 immunoglobulin domain 2 and fibronectin type III domain 2 are strongly conserved and thus are likely functionally important.

Current U.S. Class:	530/395 ; 435/320.1
Current International Class:	C07K 14/705 (20060101); C07K 14/435 (20060101); C07K 014/00 ()
Field of Search:	536/23.1 935/18,19,22 435/69.1,172.3,320.1 530/395

Fay, Sharpe, Beall, Fagan, Minnich & McKee

---

Parent Case Text

---

This is a continuation of application Ser. No. 07/904,991 filed on Jun. 26, 1992 abandoned.

---

Claims

---

Having thus described the preferred embodiments, the invention is now claimed to be:

1. The human L1 cell adhesion molecule encoded by the isolated DNA molecule (SEQ ID NO: 1) identified in FIGS. 3A amd 3B.

2. The human L1 cell adhesion molecule of claim 1, wherein said human L1 cell adhesion molecule comprises 1,256 amino acids and is of 142,698 Dalton molecular weight.

3. A cloning vector comprising the isolated DNA molecule (SEQ ID NO: 1) identified in FIGS. 3A and 3B.

---

Description

---

FIELD OF THE INVENTION

The present invention is directed to the isolation and characterization of the entire coding sequence of human L1 cell adhesion molecule (L1CAM). The invention also relates to the nucleotide sequence (SEQ ID NO: 1) characterized by the present invention and the use of this sequence for studying the role of human L1 cell adhesion molecule (L1CAM) in normal and damaged neuronal tissue. In addition, the invention is directed to the isolated and purified polypeptide chain encoded by the nucleotide sequence of the invention.

BACKGROUND OF THE INVENTION

Cell adhesion molecules (abbreviated CAMs) are neuronal cell surface glycoproteins which help to mediate the cohesive interactions between developing or regenerating neurities. It is believed that proper adhesion of neuronal cells to each other and to their surrounding extracellular matrix is essential for maintaining and/or promoting growth of the neuronal cells.

A number of cell adhesion molecules have been isolated and identified, including neural cell adhesion molecule (N-CAM), nerve growth factor-inducible large external glycoprotein (NILE), neuron-glial CAM (Ng-CAM) and closely related proteins L1 (L1 antigen). These integral membrane glycoproteins, or molecules closely related thereto, have been described by Applicants and others in the nervous system of several species.

Representative examples of such identification and description include L1cam in mouse, (Rathjen, F. G., Schachner, M., Immunocytological And Biochemical Characterization Of A New Neuronal Cell Surface Component (L1 Antigen) Which Is Involved In Cell Adhesion. EMBO J. 3:1-10 (1984)); NILE in rat, (McGuire, J. C., Greene, L. A., Furano, A. V., Nerve Growth Factor Stimulates Incorporation Of Fucose Or Glucosamine Into An External Glycoprotein In Cultures Rat PC12 Pheochromocytoma Cells. Cell 15:357-365 (1978)); Ng-CAM/8D9/G4 in chick, (Grumet, M., Edelman, G. M., Neuron-Glia Cell Adhesion Molecule Interacts with Neurons and Astroglia via Different Binding Mechanisms. J. Cell Biol. 106:487-503 (1988); and, Lemmon, V., McLoon, S., The Appearance Of An L1-Like Molecule In The Chick Primary Visual Pathway, J. Neurosci. 6:2987-2994, (1986)); and Neuroglian in Drosophila (Bieber, A. J., Snow, P. M., Hortsch, M., Patel, N. H., Jacobs, J. R., Traquina, Z. R., Schilling, J., Goodman, C. S., Drosophila Neuroglian: A Member Of The Immunoglobulin Superfamily With Extensive Homology To The Vertebrate Neural Adhesion Molecule L1. Cell 59:447-460 (1989)).

These molecules share similar biochemical properties, immunological crossreactivity, localization predominantly on axons of projection neurons, homology in nucleotide sequence as well as functional similarity.

The L1 cell adhesion molecule, which was first isolated and characterized in mouse (i.e. L1cam) is a membrane-spanning glycoprotein that has sequence similarity with both fibronectin and the immunoglobulin superfamily. Specifically, L1 cell adhesion molecules possessing six extracellular Ig-like domains, three to five fibronectin (Fn) type III-like repeats, a transmembrane segment, and a small cytoplasmic region. The membrane-spanning region links the extensive extracellular domain to the substantial cytoplasmic domain.

Several lines of evidence suggest that the L1 cell adhesion molecule plays an important role in neuronal growth and fasciculation. First, it is expressed by subpopulations of neurons in the central nervous system and on nerons and Schwann cells in the peripheral nervous system. This expression is early on in developing (Martini, R., Schachner, M., Immunoelectron Microscopic Localization Of Neural Cell Adhesion Molecules (L1, N-CAM, MAG) And Their Shared Carbohydrate Epitope And Myelin Basic Protein (MBP) In Developing Sciatic Nerve. J. Cell Biol. 103:2439-2448 (1986)) and regenerating axons (Daniloff, J. K., Chuong, C.-M., Levi, G., Edelman, G. M., Differential Distribution Of Cell Adhesion Molecules During Histogenesis Of The Chick Nervous System. J. Neurosci. 6:739-758 (1986); and, Martini, R., Schachner, M., Immunoelectron microscopic localization of neural cell adhesion molecules (L1, N-CAM, MAG) and their shared carbohydrate epitope and myelin basic protein (MBP) in developing sciatic nerve. J. Cell Biol. 103:2439-2448 (1986)).

Secondly, since antibodies to L1 disrupt fascicle formation in vitro (Stallcup, W. B., Beasley, L., Involvement Of The Nerve Growth Factor-Inducible Large External Glycoprotein (NILE) In Neurite Fasciculation In Primary Cultures Of Rat Brain. Proc. Natl. Acad. Sci. USA 82:1276-1280 (1985)) and in vivo (Landmesser, L., Dahm, L., Schultz, K., Rutishauser, U., Distinct Roles For Adhesion Molecules During Innervation Of Embryonic Chick Muscle. Dev. Biol. 130:645-670 (1988)), L1 participates in axonal fasciculate formation.

Finally, it has been shown by Applicants and others that purified L1 is a potent substrate for neurite growth and development (Lagenaur, C., Lemmon, V., A L1-Like Molecule, The 8D9 Antigen, Is A Potent Substrate For Neurite Extension. Proc. Natl. Acad. Sci. USA 84:7753-7757 (1987)).

Moreover, a number of observations are consistent with the existence of a L1 human homologue. Human tumors, especially neuroblastoma, demonstrate immunoreactivity to L1 antibodies (Mujoo, K., Spiro, R. C., Reisfeld, R. A., Characterization Of A Unique Glycoprotein Antigen Expressed On The Surface Of Human Neuroblastoma Cells. J Biol. Chem. 261:10299-10305 (1986); and, Figarella-Branger, D. F., Durbec, P. L., Rougon, G. N., Differential Spectrum Of Expression Of Neural Cell Adhesion Molecule Isoforms And L1 Adhesion Molecules On Human Neuroectodermal Tumors. Cancer Research 50:6364-6370 (1990)). In addition, Biochemical analysis of a glycoprotein isolated from human brain using an anti-neuroblastoma monoclonal antibody revealed that the antigen was very similar to mouse L1cam, Wolff, J. M., Frank, R., Mujoo, K., Spiro, R. C., Reisfeld, R. A., Rathjen, F. G., A human Brain Glycoprotein Related To The Mouse Cell Adhesion Molecule L1. J. Biol Chem. 263:11943-11947 (1988)). To conform with the HGMW approved nomenclative, (Human Gene Mapping Workshop, published 1987 in Cytogenet. Cell Genet., Vol. 46, pages 11-28) mouse L1 cell adhesion molecule is referred hereinafter as L1cam and human L1 cell adhesion molecule is referred to as L1CAM.

Recently, partial sequences obtained for a human genomic clone, Djabali, M., Mattei, M. G., Nguyen, C., Roux, D., Demengeot, J., Denizot, F., Moos, M., Schachner, M., Goridis, C., Jordan, B. R., The Gene Encoding L1, A Neural Adhesion Molecule Of The Immunoglobulin Family, Is Located On The X-Chromosome In Mouse And Man, Genomics 7:587-593 (1990) and a human melanoma cDNA clone (Harper, J. R., Prince, J. T., Healy, P. A., Stuart, J. K., Nauman, S. J., Stallcup, W. B., Isolation And Sequence Of Partial cDNA Clones of Human-L1--Homology Of Human And Rodent-L1 In The Cytoplasmic Region, J. Neurochem. 56:797-804 (1991) confirmed that a human L1-like molecule exists.

Further studies localized the gene for human L1 to the q28 band on the X chromosome (Djabali, M., Mattei, M. G., Nguyen, C., Roux, D., Demengeot, J., Denizot, F., Moos, M., Schachner, M., Goridis, C., Jordan, B. R., The Gene Encoding L1, A Neural Adhesion Molecule Of The Immunoglobulin Family, Is Located on the X-Chromosome in Mouse and Man, Genomics 7:587-593 (1990), the homologous region to the A6-B region of the mouse X chromosome where the L1cam gene is located.

The knowledge that a L1-like molecule exists in humans leads to the conclusion that L1CAM may be important in promoting axon regeneration in trauma or disease states of the human nervous system. Therefore, the Applicants have isolated and purified L1 from human brain and conducted in vitro experiments on the natural substance that demonstrate that human L1CAM, like chick and mouse L1cam, can support neuron attachment and neurite growth.

In addition, Applicants have cloned and sequenced cDNAs encompassing the entire coding region of L1CAM. This information will allow future studies on the structure and function of L1CAM and permit the construction of cell lines expressing L1CAM for in vitro and in vivo experiments on nerve growth and regeneration.

These and other objects and features of the invention will be apparent from the following description and from the claims.

SUMMARY OF THE INVENTION

In one aspect, the present invention is directed to the isolation and purification of an L1-like molecule (i.e. L1CAM) from human brain. It has been found that the isolated L1CAM molecule supports neurite growth in vitro. Applicants have also cloned and sequenced the entire coding region of human L1CAM (SEQ ID NO: 1), and found that it shows a very high degree of homology to mouse L1cam with 92% identity at the amino acid level. This similarity suggest that L1CAM is an important molecule in normal human nervous system development and nerve regeneration. Overall, there is substantially less homology to chick Ng-CAM; they are 40% identical at the amino acid level but many regions are highly conserved. Comparison of the sequences from human, mouse, chick and Drosophila, indicates that the L1 immunoglobulin domain 2 and fibronectin type III domain 2 are strongly conserved and thus are likely functionally important.

In another aspect, present invention provides for a method for isolating and completely characterizing the coding sequence of human L1CAM (SEQ ID NO: 1). Moreover, the invention provides various methods for using the identified nucleotide sequence (or DNA fragments thereof) for evaluating the function of human L1CAM in normal and damaged tissue.

In an additional aspect, the invention relates to procedures for determining and/or correcting genetic or acquired disorders of the central nervous system axonal tract.

Furthermore, the invention provides for use of the sequence information characterized to synthesize the L1CAM glycoprotein itself or fragments thereof. Along this line, the invention relates to use of the identified nucleotide sequence (or DNA parts thereof) to synthesize L1CAM or modifications of this glycoprotein into microorganisms or other hosts which use the gene to synthesize the glycoprotein.

In a further aspect, the present invention provides for use of the cDNAs for comparison of recombinant L1CAM with product purified from human brain. This permits functional studies on the recombinant molecule to be conducted. Similarly, use of the characterized cDNAs, permits the construction of cell lines expressing normal and altered L1CAM for use in transplantation and regeneration studies.

In still another aspect, the invention provides for recombinant DNA cloning vectors and transformed hosts which contain a vector which has a cDNA insert which codes for L1CAM.

BRIEF DESCRIPTION OF THE DRAWINGS

The following is a brief description of the drawings which are presented for the purpose of illustrating the invention and not for the purpose of limiting same.

FIG. 1 is a photograph of a silver stained SDS-PAGE gel of immunopurified L1CAM. The molecular weight standards are indicated at the left.

FIG. 2 is a microphotograph of E7 chick retinal explants grown on L1CAM coated dishes. Control dishes coated with BSA had no neurite outgrowth. Scale, bar=100 microns.

FIGS. 3A and 3B shows the nucleotide (bottom line) and deduced amino acid (top line) sequence of the coding portion of L1CAM (SEQ ID NO: 1). Untranslated nucleotides are not shown. The boxed nucleotides represent areas of discrepancy as compared with other published L1CAM sequence data. Underlined regions represent the oligonucleotides used for screening the library. The asterisk represents a stop codon. The nucleotide sequence for L1CAM is available through GenBank Data Libraries under Accession No. M64296.

FIGS. 4A and 4B shows a comparison at an amino acid level of L1CAM domains with corresponding domains in L1cam and chick Ng-CAM. Gaps were introduced to maximize identities between the sequences. Identical residues are represented by a hash mark. The amino acids shown as being the transmembrane region include the link between the Fn-5 domain and the presumed membrane spanning region that begins with GWFI. The amino acids shown in FIGS. 4A and 4B correspond to the amino acid sequences, SEQ ID. NOS. 4-39, set forth in the Sequence Listing.

FIG. 5 is a map of the four cloned cDNAs (i.e. 3.1, 4, 17 and C2) that code for parts of L1CAM. A scale demonstrating the size differences in base pairs is shown beside the cloned cDNAs.

DETAILED DESCRIPTION OF THE INVENTION

L1CAM Purification

L1CAM was isolated and purified by immunoaffinity chromatography using similar purification methods previously described by the Applicants (Lemmon, V., Farr, K., Lagenaur, L1 Mediated Axon Outgrowth Occurs Via A Homophilic Binding Mechanism. Neuron 2:1597-1603 (1989)). Briefly, neural membranes from 12 day full term neonatal human brain (the infant succumbed from complications of Trisomy 18) were isolated on sucrose gradients and then extracted with 1% deoxycholate. The extract was then run over a 74-5H7 IgG monoclonal antibody to L1cam affinity column (Lemmon, V., Farr, K., Lagenaur, C., L1 Mediated Axon Outgrowth Occurs Via A Homophilic Binding Mechanism. Neuron 2:1597-1603 (1989)). Antigens were eluted with 0.1 M diethylamine (pH 11.5) and the solution rapidly neutralized with Tris-HCl. Fractions were then dialyzed against PBS overnight. Gel electrophoresis of the purified product was performed on a 5% SDS-polyacrylamide gel.

A silver stained SDS-polyacrylamide gel of purified L1CAM is shown in FIG. 1. Notable is the characteristic doublet of bands at 190-180 kDa, a major band at 130 kDa, and minor bands at 105 kDa, 80 kDa, and 62 kDa. This is similar to the pattern reported by others for L1CAM (Mujoo, K., Spiro, R. C., Reisfeld, R. A., Characterization Of A Unique Glycoprotein Antigen Expressed On The Surface Of Human Neuroblastoma Cells. J Biol. Chem. 261:10299-10305 (1986); and, Wolff, J. M., Frank, R., Mujoo, K., Spiro, R. C., Reisfeld, R. A., Rathjen, F. G., A Human Brain Glycoprotein Related To The Mouse Cell Adhesion Molecule L1. J Biol Chem. 263:11943-11947 (1988)), chick Ng-CAM (Burgoon, M. P., Grumet, M., Mauro, V., Edelman, G. M., Cunningham, B. A., Structure Of The Chicken Neuron-Glial Cell Adhesion Molecule, Ng-CAM: Origin Of The Polypeptides And Relation To The Ig Superfamily. J. Cell Biol. 112:1017-1029 (1991) and L1cam (Sadoul, K., Sadoul, R., Faissner, A., Schachner, M., Biochemical Characterization Of Different Molecular Forms Of The Neural Cell Adhesion Molecule L1. J. Neurochem 50:510-521 (1988).

Cell Culture

Functional assays of the L1CAM purified from human brain were performed by two neuronal culture methods. Dissociated P1 rat cerebellar cells were plated on L1CAM-nitrocellulose coated plates as previously described by Applicant (Lemmon, V., Farr, K., Lagenaur, C., L1 Mediated Axon Outgrowth Occurs Via A Homophilic Binding Mechanism. Neuron 2:1597-1603 (1989). E7 chick retinal strips were grown on L1CAM-nitrocellulose coated plates based on a system developed by Halfter et al. (Halfter, W., Claviez, M., Schwarz, U., Preferential Adhesion Of Tectal Membranes To Anterior Embryonic Chick Retina Neurites. Nature 292:67-70 (1981)). Plain nitrocellulose coated with bovine serum albumin was used as a negative control substrate.

As shown in FIG. 2, purified L1CAM was extremely potent in supporting neurite outgrowth. Chick retinal explants produced extended defasciculated neurites on L1CAM (FIG. 2) and dissociated rat cerebellar neurons grew long neurites. Controls grown on nitrocellulose without L1CAM showed poor attachment and no neurite extension.

Molecular Cloning

A human fetal brain cDNA library in Lambda ZAP.RTM. II (Stratagene, La Jolla, Calif.) was amplified in the E. coli strain XL1-Blue (Stratagene, La Jolla, Calif.). The library was probed with a .sup.32 P 5' end labelled synthetic degenerate oligonucleotides, 50 nucleotides in length (i.e. GAGGACACCCAGGTGGACTCTGAGGCCCGACCGATGAAAGATGAGACCTT) (SEQ ID NO: 2), corresponding to a region that is highly conserved between L1cam and the rat homologue NILE glycoprotein (Prince, J. T., Milona, N., Stallcup, W. B., Characterization Of A Partial cDNA Clone For The NILE Glycoprotein And Identification Of The Encoded Polypeptide Domain. J. Neurosci 9:1825-1834 (1989)). The screening was carried out overnight at 30.degree. C. in a solution containing 6xSSC, 5xDenhardts, 0.5% SDS (sodium dodecyl sulfate), 20% formamide and 100 ug/ml salmon sperm DNA.

A total of 3.times.10.sup.6 placques were screened, representing a three-fold screening of the library. Twenty placques were initially positive, however only three of the clones initially isolated from the cDNA library remained positive after successive rounds of screening and proved subsequently to correspond to L1CAM cDNA. After excision of the inserts from the phage vector, these clones were 3.4, 2.6, and 1.4 kb in length and were designated 3.1, 4 and 17 respectively. See FIG. 5. Because none of these contained a start methionine and initial signal sequence, a second screening of the library was performed using a 40 base oligonucleotide (i.e. TGCCACGCCCACTTCCCAGGCACCAGGACCATCATTCAGA) (SEQ ID NO: 3) deduced from sequencing the 5' end of clone 3.1. A positive clone from this screening, C2, contained an initiation codon preceded by a stop codon and followed by sequence that corresponded to a hydrophobic stretch of amino acids that is presumed to be a signal sequence, as well as sequence that overlapped with the previously obtained clones. This clone was 1.2 kb in length.

DNA Sequencing

Double stranded DNA sequencing was carried out by the dideoxynucleotide method (Sanger, F. S., Nicklen, S., Coulson, A. R., DNA Sequencing With Chain Terminating Inhibitors. Proc. Natl. Acad. Sci. USA 74:5463-5467 (1977)) using a Sequenase Kit (USBC, Cleveland, Ohio) and .sup.35 S-deoxyadenosine 5'-(thio)triphosphate from Amersham, Arlington Heights, Ill. The primers for the reactions were custom synthesized. Sequencing primers to the T7 and T3 promoters were used for the initial sequencing, and subsequent sequencing was done using additional synthetic oligonucleotide primers generated from the newly acquired the newly acquired L1CAM sequence. The complete sequence was obtained from both DNA strands. Sequence analysis was carried out using the MacVector.RTM. (IBI) sequence analysis program.

The nucleotide (lower line) and deduced amino acid (upper line) sequence for the L1CAM cDNA coding region is shown in FIGS. 3A and 3B. The open reading frame encodes a protein of 1,256 amino acids and 142,698 Dalton molecular weight. The nucleotide sequence for L1CAM (SEQ ID NO: 1) has been deposited with EMBL/GenBank Data Libraries under Accession No. M64296.

The nucleotide sequences of the human L1CAM and mouse L1cam cDNAs were compared and found to be 85% identical. At the amino acid level, this rose to 92% overall identity (FIGS. 4A amd 4B).

Structurally, L1-related molecules are similar to other immunoglobulin superfamily cell adhesion molecules having a motif of repeating immunoglobulin domains followed by fibronectin type III domains. The L1-like molecules in particular have 6 repeating immunoglobulin C2 (Ig) domains followed by 5 repeating fibronectin type III (Fn) domains (Moos, M., Tacke, R., Scherer, H., Teplow, D., Fruh, K., Schachner, M., Neural Adhesion Molecule L1 As A Member Of The Immunoglobulin Superfamily With Binding Domains Similar To Fibronectin. Nature 334:701-703 (1988); and, Burgoon, M. P., Grumet, M., Mauro, V., Edelman, G. M., Cunningham, B. A., Structure Of The Chicken Neuron-Glial Cell Adhesion Molecule, Ng-CAM: Origin Of The Polypeptides And Relation To The Ig Superfamily. J. Cell Biol. 112:1017-1029 (1991)). These are linked to a cytoplasmic portion of the molecule by a transmembrane domain.

A domain by domain comparison of the protein sequence of human L1CAM to mouse L1cam, chick Ng-CAM, and Drosophila neuroglian was performed and is summarized below in Table 1.

TABLE 1 __________________________________________________________________________ Percentage Identity of Amino Acids in Different Domains Compared to Human L1 Domain Ig 1 Ig 2 Ig 3 Ig 4 Ig 5 Ig 6 Fn 1 Fn 2 Fn 3 Fn 4 Fn 5 TM CP __________________________________________________________________________ ML1cam 83 93 91 87 90 93 89 89 86 82 75 94 100 NGCAM 44 66 55 57 39 43 38 56 33 30 18 78 63 NGCAM* 62 83 71 79 66 56 67 73 58 49 32 100 75 Neuroglian 26 32 27 24 29 32 32 36 31 29 18 22 26 Neuroglian* 41 54 47 49 49 48 51 68 50 52 40 67 40 __________________________________________________________________________

As indicated above, two short stretches of L1CAM nucleotide sequence have been published previously. A comparison of the genomic sequence obtained by Dijalbi et al. (Djabali, M., Mattei, M. G., Nguyen, C., Roux, D., Demengeot, J., Denizot, F., Moos, M., Schachner, M., Goridis, C., Jordan, B. R., The Gene Encoding L1, A Neural Adhesion Molecule Of The Immunoglobulin Family, Is Located On The X-Chromosome In Mouse And Man. Genomics 7:587-593 (1990)) with Applicants is an identical match from nucleotides 991-1091. See FIGS. 3A and 3B. The first 23 nucleotides of the Dijalbi sequence, however, did not match Applicants sequence or the L1cam sequence and likely represents an intron.

The sequence obtained by Harper et al. (Harper, J. R., Prince, J. T., Healy, P. A., Stuart, J. K., Nauman, S. J., Stallcup, W. B., Isolation And Sequence Of Partial cDNA Clones Of Human-L1--Homology Of Human And Rodent-L1 In The Cytoplasmic Region. J Neurochem 56:797-804 (1991)) from human melanoma cDNA differs from Applicants at L1CAM nucleotides 3528 to 3540 where Harper et al. show a 12 nucleotide deletion. See FIGS. 3A and 3B. Applicants obtained identical sequence for this region from three independent clones and the sequence matches the corresponding mouse nucleotide sequence perfectly. This discrepancy could represent a mutation in the tumor line or a splicing variant. The sequence also varies between nucleotides 3344-3349 where Harper et al. have an extra 3 nucleotides introduced non-sequentially. Interestingly, Applicants found a one amino acid deletion here as compared to the mouse L1cam sequence with matching of the flanking amino acids on either side. This region was particularly difficult to sequence on the anti-sense strand, requiring dITP reactions to resolve compressions. The coding strand, however, had unambiguous sequence. Applicants found a final difference at base 3086 where Applicants have an A.

A comparison of the sequences of human L1CAM and mouse L1cam with Ng-CAM in FIG. 4 raises a question about the relationship between mammalian L1 and Ng-CAM: are they homologous? Burgoon et al. have suggested that Ng-CAM may not be "equivalent" to L1 due to the relatively low sequence (40%) identity between the two molecules (Burgoon, M. P., Grumet, M., Mauro, V., Edelman, G. M., Cunningham, B. A., Structure Of The Chicken Neuron-Glial Cell Adhesion Molecule, Ng-CAM: Origin Of The Polypeptides And Relation To The Ig Superfamily. J. Cell Biol. 112:1017-1029 (1991)). In contrast, mouse NCAM is about 80% identical with chick NCAM and rat fibronectin is about 80% identical with chick fibronectin. They also state that "experiments to identify an L1 homologue in chickens and an Ng-CAM homologue in mice have not yet revealed such molecules".

Despite the poor sequence homology between Ng-CAM and mammalian L1, there are many similarities among the molecules. If conservative amino acid substitutions in Ng-CAM are permitted, the overall similarity between L1CAM and Ng-CAM rises to 66%. The Ig domains show relatively higher degrees of similarity, up to 83%, with 75% conservation of the cytoplasmic domain. Furthermore, the overall structure of the molecule is preserved from species to species; there are 6 Ig domains and 5 Fn domains in each molecule and each structural domain in the chick molecule is most closely related to the same domain in the human. The domains that show the highest degree of similarity between human and mouse (Ig 2, Fn 2, the transmembrane and cytoplasmic domain) also demonstrate the most similarity between human and chick. The relatively variable domains between human L1CAM and mouse L1cam (Ig 1, Fn 4 and Fri 5) also have relatively low homologies between human and chick. This is also true when comparing L1CAM to Drosophila neuroglian.

Immunological and biochemical experiments demonstrate many similarities between mammalian L1 and Ng-CAM. Antibodies against mammalian L1 from different species crossreact with Ng-CAM. Purification of L1 and Ng-CAM from brain produces a similar polypeptide pattern on SDS-PAGE and there is substantial evidence that there are protease sensitive sites at the same two locations in both L1 and Ng-CAM (Sadoul, R., Kirchhoff, F., Schachner, M., A Protein Kinase Activity Is Associated With And Specifically Phosphorylates The Neural Cell Adhesion Molecule L1. J. Neurochem. 53:1471-1478 (1988); Prince, J. T., Milona, N., Stallcup, W. B., Characterization Of A Partial cDNA Clone For The NILE Glycoprotein And Identification Of The Encoded Polypeptide Domain. J. Neurosci. 9:1825-1834 (1989); and, Burgoon, M. P., Grumet, M., Mauro, V., Edelman, G. M., Cunningham, B. A., Structure Of The Chicken Neuron-Glial Cell Adhesion Molecule, Ng-CAM: Origin Of The Polypeptides And Relation To The Ig Superfamily. J. Cell Biol. 112:1017-1029 (1991)). The anatomical distribution of L1, despite minor variations, shows striking similarity between chick and mammals. For example, almost all projection axons in the CNS and PNS express L1 or Ng-CAM in the corresponding species.

Functional experiments have shown that anti-L1 and anti-Ng-CAM antibodies disrupt axon fasciculation in both chicks and mammals (Stallcup, W. B., Beasley, L., Involvement Of The Nerve Growth Factor-Inducible Large External Glycoprotein (NILE) In Neurite Fasciculation In Primary Cultures Of Rat Brain. Proc. Natl. Acad. Sci. USA 82:1276-1280 (1985); and, Rathjen, F. G., Schachner, M., Immunocytological And Biochemical Characterization Of A New Neuronal Cell Surface Component (L1 Antigen) Which Is Involved In Cell Adhesion. EMBO J. 3:1-10 (1984)) and inhibit neuron-neuron adhesion (Keilhauer, G., Faissner, A., Schachner, M., Differential Inhibition Of Neurone-Neurone, Neurone-Astrocyte and Astrocyte-Astrocyte Adhesion By L1, L2 And N-CAM Antibodies. Nature 316:728-730 (1985); Grumet, M., Hoffman, S., Edelman, G. M., Two Antigenically Related Neuronal Cell Adhesion Molecules Of Different Specificities Mediate Neuron-Neuron And Neuron-Glia Adhesion. Proc. Natl. Acad. Sci. USA 81:267-271 (1984)). They also perturb migration of granule cells from the external granule cell layer to the internal granule cell layer in the cerebellum (Lindner, J., Rathjen, F. G., Schachner, M., L1 mono- and polyclonal antibodies modify cell migration in early postnatal mouse cerebellum. Nature 305:427-430 (1983); and, Hoffman, S., Friedlander, D. R., Chuong, C.-M., Grumet, M., Edelman, G. M., Differential Contributions Of Ng-CAM And N-CAM To Cell Adhesion In Different Neural Regions. J. Cell Biol. 103:145-158. (1986)).

Finally, studies with purified L1 and with Ng-CAM show that mammalian cells can bind to chick Ng-CAM and that chick neurons can bind to mammalian L1 in a homophilic binding interaction between the L1cam and the chick Ng-CAM (Lemmon, V., Farr, K., Lagenaur, C., L1 Mediated Axon Outgrowth Occurs Via A Homophilic Binding Mechanism. Neuron 2:1597-1603 (1989)). Therefore, while there are clearly structural differences between Ng-CAM and L1 it seems most likely that they represent homologous and not merely analogous molecules.

Comparison of L1CAM, L1cam, rat NILE and chick Ng-CAM confirms previous reports that the cytoplasmic portion of this molecule is very highly conserved, suggesting an important functional role for this region of the molecule (Prince, J. T., Milona, N., Stallcup, W. B., Characterization Of A Partial cDNA Clone For The NILE Glycoprotein And Identification Of The Encoded Polypeptide Domain. J. Neurosci. 9:1825-1834 (1989); and, Harper, J. R., Prince, J. T., Healy, P. A., Stuart, J. K., Nauman, S. J., Stallcup, W. B., Isolation And Sequence Of Partial cDNA Clones of Human-L1--Homology Of Human And Rodent-L1 In The Cytoplasmic Region. J. Neurochem 56:797-804 (1991)). Evidence points to an interaction of L1 with the cytoskeleton, directly or indirectly, because in differentiated neuroblastomas L1 is relatively immobile (Pollerberg, G. E., Davoust, J., Schachner, M., Lateral Mobility Of The Cell Adhesion Molecule-L1 Within The Surface Membrane Of Morphologically Undifferentiated And Differentiated Neuroblastoma Cells. European Journal of Neuroscience 2:712-717 (1990)).

However, on axons and growth cones of chick retinal ganglion cells, L1 is freely diffusible (Drazba, J., Lemmon, V., Cell adhesion molecules 8D9 and NCAM move independently in the plane of axon membranes. Soc. for Neurosci., St. Louis, Mo., (1990)). This suggests that attachment to the cytoskeleton is not a prerequisite for functional binding as is the case for cadherins (Nagafuchi, A., Takeichi, M., Cell binding function of E-cadherin is regulated by the cytoplasmic domain. EMBO J. 7:3679-3684 (1988)).

The cytoplasmic domain of L1 also may be involved in regulating cell adhesion molecule function. L1 is phosphorylated and is associated with a casein kinase (Sadoul, R., Kirchhoff, F., Schachner, M., A Protein Kinase Activity Is Associated With And Specifically Phosphorylates The Neural Cell Adhesion Molecule L1. J. Neurochem. 53:1471-1478 (1988)). Anti-L1 antibody binding to L1 on has been shown to alter intracellular calcium and pH (Schuch, U., Lohse, M. J., Schachner, M., Neural Cell Adhesion Molecules Influence Second Messenger Systems. Neuron (1989)). Agents such as TPA or okadaic acid that increase cytoplasmic phosphorylation increase fasciculation in a manner consistent with increased affinity of L1 for its ligand (unpublished results; Cervello, Lemmon, Rutishauser). This evidence indicates that L1 either regulates cell function or has its function regulated via its cytoplasmic region.

Interspecies comparison of the amino acid sequence of the extracellular portion of L1 suggests that the Ig domain 2 and Fn domain 2 may have some conserved function since these are the immunoglobulin and fibronectin domains with greatest homology. One possibility is that the Ig domain 2 is important in L1--L1 homophilic binding. The Ig domains 2 and 3 of NCAM are believed to be involved in heparin and cell binding (Frelinger, A. L., Rutishauser, U., Topography of N-CAM Structural And Functional Determinants II. Placement Of Monoclonal Antibody Epitopes. J. Cell Biol. 103:1729-1737 (1986); and, Cole, G. J., Akeson, R., Identification If A Heparin Binding Domain Of The Neural Cell Adhesion Molecule N-CAM Using Synthetic Peptides. Neuron 2:1157-1165 (1989)). This demonstrates that Ig superfamily molecules do not necessarily bind amino terminus to amino terminus. It is also possible that a large region of L1 is involved in L1--L1 binding, similar to the manner in which Ig heavy chains bind to each other; according to this model, the L1 Ig domains would bind in a long parallel or anti-parallel interaction.

This possibility is consistent with the report that all monoclonal antibodies to G4 (thought to be identical with chick Ng-CAM) that were tested were able to inhibit G4--G4 binding (Chang, S., Rathjen, F. G., Raper, J. A., Neurite Outgrowth Promoting Activity Of G4 And Its Inhibition By Monoclonal Antibodies. J Neurosc R 25:180-186 (1990)). No highly positively charged regions were observed in any of the Ig domains that would be analogous to the heparin binding domain in the second Ig domain of NCAM (Cole, G. J., Akeson, R., Identification Of A Heparin Binding Domain Of The Neural Cell Adhesion Molecule N-CAM Using Synthetic Peptides. Neuron 2:1157-1165 (1989)). However, the second Ig domain of L1 and Ng-CAM does have a highly negatively charged region with 4 out of 6 amino acids being aspartic acid or glutamic acid. The third Fn domain of L1 has one region with 9 out of 12 positively charged amino acids. A similar region is present in L1cam but is absent from chick. Conclusions about structure-function relations must await more detailed experiments using well defined antibodies and mutated forms of L1.

The information provided above extends previous work by providing the entire coding sequence of human L1CAM and demonstrating that like the related molecules in mouse, rat and chick, L1CAM purified from human brain can support neurite growth. The structural knowledge gained allows comparisons with nearby and more distant species, mice, chick and Drosophila and speculation about structurally important areas of the molecule. The results of in vitro testing of natural L1CAM support the idea that L1CAM is likely to be an important molecule in the development of the human nervous system by providing evidence that L1CAM can mediate neurite growth. This complements reports that the human L1 gene is on the X chromosome in a region were disease of CNS axonal tract development has been mapped (Djabali et al., 1990), and strengthens the need for further understanding of the molecule. Use of the cDNA will enable comparison of recombinant L1CAM with the product purified from human brain and permit functional studies on the recombinant molecule in vitro. Moreover, using the cDNA, cell lines can be constructed expressing normal and altered L1CAM for use in transplantation or regeneration studies.

Furthermore, as a result of the isolation and complete characterization of the nucleotide sequence, the present invention is also directed to the use of the nucleotide sequence (SEQ ID NO: 1) and/or the cDNA clones thereof, for tests that can be used to determine genetic or acquired disorders of neuronal cells using L1CAM DNA probes specific for the identified nucleotide sequence (or DNA fragments thereof) or antibodies to the products coded by the nucleotide sequence or cDNA. More particularly, such uses include a method for identifying the gene coding for the L1CAM which comprises hybridizing a cDNA which codes for part of the L1CAM with human genomic DNA, and determining whether the cDNA anneals to the genomic DNA.

In addition, the present invention relates to the use of gene fragments generated through amplification from human genomic or cloned DNA for detection and analysis of the gene, such as in the detection of mutations. The gene can be used for the production of L1CAM protein. A method for amplifying a nucleotide sequence specific for the human gene for the L1CAM from biological samples containing human genomic DNA using the synthetic oligonucleotide primers of the present invention which contain either a nucleotide sequence from the gene or from the cDNAs encoding axions of the genes, such a method would comprise the steps of synthesizing the oligonucleotides containing the nucleotide sequence wherein the nucleotide sequence are specific for the gene for the L1CAM, allowing the oligonucleotides to anneal to the specific sequences in the sample containing the human genomic DNA, synthesizing a copy of each strand of the DNA by polymerase chain reaction, and denaturing the sample to separate the DNA strands from each other.

Moreover, as elaborated above, the present invention also relates to the potential use of the nucleotide sequence synthesized above for cloning purposes. Other alterative embodiments for new and unique uses of nucleotide sequences, the CDNA clones, etc. may be utilized by procedures that are well known in the art.

The invention has been described with reference to the preferred embodiments. Obviously, modifications and alterations will occur to others upon reading and understanding the preceding detailed description. It is intended that all such alterations and modifications insofar as they come within the scope of the appended claims or the equivalents thereof.

__________________________________________________________________________ SEQUENCE LISTING (1) GENERAL INFORMATION: (iii) NUMBER OF SEQUENCES: 39 (2) INFORMATION FOR SEQ ID NO: 1: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 3774 (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (iii) HYPOTHETICAL: irrelevant (iv) ANTI-SENSE: no (vi) ORIGINAL SOURCE: (A) ORGANISM: Homo Sapiens (B) INDIVIDUAL ISOLATE: 17-18 week fetus (vii) IMMEDIATE SOURCE: (A) LIBRARY: Stratagene cDNA Library 936206 (B) CLONE: synthesis of 4 clones (x) PUBLICATION INFORMATION: (A) AUTHORS: Hlavin, Mary Louise Lemmon, Vance (B) TITLE: Molecular structure and functional testing of human L1CAM: an interspecies comparison. (C) JOURNAL: GENOMICS (D) VOLUME: 11 (E) ISSUE: (F) PAGES: 416-423 (G) DATE: 1991 (K) RELEVANT RESIDUES IN SEQ ID NO: 1 to 3774 (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 1: ATGGTCGTGGCGCTGCGGTACGTGTGGCCTCTCCTCCTCTGCAGCCCC48 MetValValAlaLeuArgTyrValTrpProLeuLeuLeuCysSerPro 151015 TGCCTGCTTATCCAGATCCCCGAGGAATATGAAGGACACCATGTGATG96 CysLeuLeuIleGlnIleProGluGluTyrGluGlyHisHisValMet 202530 GAGCCACCTGTCATCACGGAACAGTCTCCACGGCGCCTGGTTGTCTTC144 GluProProValIleThrGluGlnSerProArgArgLeuValValPhe 354045 CCCACAGATGACATCAGCCTCAAGTGTGAGGCCAGTGGCAAGCCCGAA192 ProThrAspAspIleSerLeuLysCysGluAlaSerGlyLysProGlu 505560 GTGCAGTTCCGCTGGACGAGGGATGGTGTCCACTTCAAACCCAAGGAA240 ValGlnPheArgTrpThrArgAspGlyValHisPheLysProLysGlu 65707580 GAGCTGGGTGTGACCGTGTACCAGTCGCCCCACTCTGGCTCCTTCACC288 GluLeuGlyValThrValTyrGlnSerProHisSerGlySerPheThr 859095 ATCACGGGCAACAACAGCAACTTTGCTCAGAGGTTCCAGGGCATCTAC336 IleThrGlyAsnAsnSerAsnPheAlaGlnArgPheGlnGlyIleTyr 100105110 CGCTGCTTTGCCAGCAATAAGCTGGGCACCGCCATGTCCCATGAGATC384 ArgCysPheAlaSerAsnLysLeuGlyThrAlaMetSerHisGluIle 115120125 CGGCTCATGGCCGAGGGTGCCCCCAAGTGGCCAAAGGAGACAGTGAAG432 ArgLeuMetAlaGluGlyAlaProLysTrpProLysGluThrValLys 130135140 CCCGTGGAGGTGGAGGAAGGGGAGTCAGTGGTTCTGCCTTGCAACCCT480 ProValGluValGluGluGlyGluSerValValLeuProCysAsnPro 145150155160 CCCCCAAGTGCAGAGCCTCTCCGGATCTACTGGATGAACAGCAAGATC528 ProProSerAlaGluProLeuArgIleTyrTrpMetAsnSerLysIle 165170175 TTGCACATCAAGCAGGACGAGCGGGTGACGATGGGCCAGAACGGCAAC576 LeuHisIleLysGlnAspGluArgValThrMetGlyGlnAsnGlyAsn 180185190 CTCTACTTTGCCAATGTGCTCACCTCCGACAACCACTCAGACTACATC624 LeuTyrPheAlaAsnValLeuThrSerAspAsnHisSerAspTyrIle 195200205 TGCCACGCCCACTTCCCAGGCACCAGGACCATCATTCAGAAGGAACCC672 CysHisAlaHisPheProGlyThrArgThrIleIleGlnLysGluPro 210215220 ATTGACCTCCGGGTCAAGGCCACCAACAGCATGATTGACAGGAAGCCG720 IleAspLeuArgValLysAlaThrAsnSerMetIleAspArgLysPro 225230235240 CGCCTGCTCTTCCCCACCAACTCCAGCAGCCACCTGGTGGCCTTGCAG768 ArgLeuLeuPheProThrAsnSerSerSerHisLeuValAlaLeuGln 245250255 GGGCAGCCATTGGTCCTGGAGTGCATCGCCGAGGGCTTTCCCACGCCC816 GlyGlnProLeuValLeuGluCysIleAlaGluGlyPheProThrPro 260265270 ACCATCAAATGGCTGCGCCCCAGTGGCCCCATGCCAGCTGACCGTGTC864 ThrIleLysTrpLeuArgProSerGlyProMetProAlaAspArgVal 275280285 ACCTACCAGAACCACAACAAGACCCTGCAGCTGCTGAAAGTGGGCGAG912 ThrTyrGlnAsnHisAsnLysThrLeuGlnLeuLeuLysValGlyGlu 290295300 GAGGATGATGGCGAGTACCGCTGCCTGGCCGAGAACTCACTGGGCAGT960 GluAspAspGlyGluTyrArgCysLeuAlaGluAsnSerLeuGlySer 305310315320 GCCCGGCATGCGTACTATGTCACCGTGGAGGCTGCCCCGTACTGGCTG1008 AlaArgHisAlaTyrTyrValThrValGluAlaAlaProTyrTrpLeu 325330335 CACAAGCCCCAGAGCCATCTATATGGGCCAGGAGAGACTGCCCGCCTG1056 HisLysProGlnSerHisLeuTyrGlyProGlyGluThrAlaArgLeu 340345350 GACTGCCAAGTCCAGGGCAGGCCCCAACCAGAGGTCACCTGGAGAATC1104 AspCysGlnValGlnGlyArgProGlnProGluValThrTrpArgIle 355360365 AACGGGATCCCTGTGGAGGAGCTGGCCAAAGACCAGAAGTACCGGATT1152 AsnGlyIleProValGluGluLeuAlaLysAspGlnLysTyrArgIle 370375380 CAGCGTGGCGCCCTGATCCTGAGCAACGTGCAGCCCAGTGACACAATG1200 GlnArgGlyAlaLeuIleLeuSerAsnValGlnProSerAspThrMet 385390395400 GTGACCCAATGTGAGGCCCGCAACCGGCACGGGCTCTTGCTGGCCAAT1248 ValThrGlnCysGluAlaArgAsnArgHisGlyLeuLeuLeuAlaAsn 405410415 GCCTACATCTACGTTGTCCAGCTGCCAGCCAAGATCCTGACTGCGGAC1296 AlaTyrIleTyrValValGlnLeuProAlaLysIleLeuThrAlaAsp 420425430 AATCAGACGTACATGGCTGTCCAGGGCAGCACTGCCTACCTTCTGTGC1344 AsnGlnThrTyrMetAlaValGlnGlySerThrAlaTyrLeuLeuCys 435440445 AAGGCCTTCGGAGCGCCTGTGCCCAGTGTTCAGTGGCTGGACGAGGAT1392 LysAlaPheGlyAlaProValProSerValGlnTrpLeuAspGluAsp 450455460 GGGACAACAGTGCTTCAGGACGAACGCTTCTTCCCCTATGCCAATGGG1440 GlyThrThrValLeuGlnAspGluArgPhePheProTyrAlaAsnGly 465470475480 ACCCTGGGCATTCGAGACCTCCAGGCCAATGACACCGGACGCTACTTC1488 ThrLeuGlyIleArgAspLeuGlnAlaAsnAspThrGlyArgTyrPhe 485490495 TGCCTGGCTGCCAATGACCAAAACAATGTTACCATCATGGCTAACCTG1536 CysLeuAlaAlaAsnAspGlnAsnAsnValThrIleMetAlaAsnLeu 500505510 AAGGTTAAAGATGCAACTCAGATCACTCAGGGGCCCCGCAGCACAATC1584 LysValLysAspAlaThrGlnIleThrGlnGlyProArgSerThrIle 515520525 GAGAAGAAAGGTTCCAGGGTGACCTTCACGTGCCAGGCCTCCTTTGAC1632 GluLysLysGlySerArgValThrPheThrCysGlnAlaSerPheAsp 530535540 CCCTCCTTGCAGCCCAGCATCACCTGGCGTGGGGACGGTCGAGACCTC1680 ProSerLeuGlnProSerIleThrTrpArgGlyAspGlyArgAspLeu 545550555560 CAGGAGCTTGGGGACAGTGACAAGTACTTCATAGAGGATGGGCGCCTG1728 GlnGluLeuGlyAspSerAspLysTyrPheIleGluAspGlyArgLeu 565570575 GTCATCCACAGCCTGGACTACAGCGACCAGGGCAACTACAGCTGCGTG1776 ValIleHisSerLeuAspTyrSerAspGlnGlyAsnTyrSerCysVal 580585590 GCCAGTACCGAACTGGATGTGGTGGAGAGTAGGGCACAGCTCTTGGTG1824 AlaSerThrGluLeuAspValValGluSerArgAlaGlnLeuLeuVal 595600605 GTGGGGAGCCCTGGGCCGGTGCCACGGCTGGTGCTGTCCGACCTGCAC1872 ValGlySerProGlyProValProArgLeuValLeuSerAspLeuHis 610615620 CTGCTGACGCAGAGCCAGGTGCGCGTGTCCTGGAGTCCTGCAGAAGAC1920 LeuLeuThrGlnSerGlnValArgValSerTrpSerProAlaGluAsp 625630635640 CACAATGCCCCCATTGAGAAATATGACATTGAATTTGAGGACAAGGAA1968 HisAsnAlaProIleGluLysTyrAspIleGluPheGluAspLysGlu 645650655 ATGGCGCCTGAAAAATGGTACAGTCTGGGCAAGGTTCCAGGGAACCAG2016 MetAlaProGluLysTrpTyrSerLeuGlyLysValProGlyAsnGln 660665670 ACCTCTACCACCCTCAAGCTGTCGCCCTATGTCCACTACACCTTTAGG2064 ThrSerThrThrLeuLysLeuSerProTyrValHisTyrThrPheArg 675680685 GTTACTGCCATAAACAAATATGGCCCCGGGGAGCCCAGCCCGGTCTCT2112 ValThrAlaIleAsnLysTyrGlyProGlyGluProSerProValSer 690695700 GAGACTGTGGTCACACCTGAGGCAGCCCCAGAGAAGAACCCTGTGGAT2160 GluThrValValThrProGluAlaAlaProGluLysAsnProValAsp 705710715720 GTGAAGGGGGAAGGAAATGAGACCACCAATATGGTCATCACGTGGAAG2208 ValLysGlyGluGlyAsnGluThrThrAsnMetValIleThrTrpLys 725730735 CCGCTCCGGTGGATGGACTGGAACGCCCCCCAGGTTCAGTACCGCGTG2256 ProLeuArgTrpMetAspTrpAsnAlaProGlnValGlnTyrArgVal 740745750 CAGTGGCGCCCTCAGGGGACACGAGGGCCCTGGCAGGAGCAGATTGTC2304 GlnTrpArgProGlnGlyThrArgGlyProTrpGlnGluGlnIleVal 755760765 AGCGACCCCTTCCTGGTGGTGTCCAACACGTCCACCTTCGTGCCCTAT2352 SerAspProPheLeuValValSerAsnThrSerThrPheValProTyr 770775780 GAGATCAAAGTCCAGGCCGTCAACAGCCAGGGCAAGGGACCAGAGCCC2400 GluIleLysValGlnAlaValAsnSerGlnGlyLysGlyProGluPro 785790795800 CAGGTCACTATCGGCTACTCTGGAGAGGACTACCCCCAGGCAATCCCT2448 GlnValThrIleGlyTyrSerGlyGluAspTyrProGlnAlaIlePro 805810815 GAGCTGGAAGGCATTGAAATCCTCAACTCAAGTGCCGTGCTGGTCAAG2496 GluLeuGluGlyIleGluIleLeuAsnSerSerAlaValLeuValLys 820825830 TGGCGGCCGGTGGACCTGGCCCAGGTCAAGGGCCACCTCCGCGGATAC2544 TrpArgProValAspLeuAlaGlnValLysGlyHisLeuArgGlyTyr 835840845 AATGTGACGTACTGGAGGGAGGGCAGTCAGAGGAAGCACAGCAAGAGA2592 AsnValThrTyrTrpArgGluGlySerGlnArgLysHisSerLysArg 850855860 CATATCCACAAAGACCATGTGGTGGTGCCCGCCAACACCACCAGTGTC2640 HisIleHisLysAspHisValValValProAlaAsnThrThrSerVal 865870875880 ATCCTCAGTGGCTTGCGGCCCTATAGCTCCTACCACCTGGAGGTGCAG2688 IleLeuSerGlyLeuArgProTyrSerSerTyrHisLeuGluValGln 885890895 GCCTTTAACGGGCGAGGATCGGGGCCCGCCAGCGAGTTCACCTTCAGC2736 AlaPheAsnGlyArgGlySerGlyProAlaSerGluPheThrPheSer 900905910 ACCCCAGAGGGAGTGCCTGGCCACCCCGAGGCGTTGCACCTGGAGTGC2784 ThrProGluGlyValProGlyHisProGluAlaLeuHisLeuGluCys 915920925 CAGTCGAACACCAGCCTGCTGCTGCGCTGGCAGCCCCCACTCAGCCAC2832 GlnSerAsnThrSerLeuLeuLeuArgTrpGlnProProLeuSerHis 930935940 AACGGCGTGCTCACCGGCTACGTGCTCTCCTACCACCCCCTGGATGAG2880 AsnGlyValLeuThrGlyTyrValLeuSerTyrHisProLeuAspGlu 945950955960 GGGGGCAAGGGGCAACTGTCCTTCAACCTTCGGGACCCCGAACTTCGG2928 GlyGlyLysGlyGlnLeuSerPheAsnLeuArgAspProGluLeuArg 965970975 ACACACAACCTGACCGATCTCAGCCCCCACCTGCGGTACCGCTTCCAG2976 ThrHisAsnLeuThrAspLeuSerProHisLeuArgTyrArgPheGln 980985990 CTTCAGGCCACCACCAAAGAGGGCCCTGGTGAAGCCATCGTACGGGAA3024 LeuGlnAlaThrThrLysGluGlyProGlyGluAlaIleValArgGlu 99510001005 GGAGGCACTATGGCCTTGTCTGGGATCTCAGATTTTGGCAACATCTCA3072 GlyGlyThrMetAlaLeuSerGlyIleSerAspPheGlyAsnIleSer 101010151020 GCCACAGCGGGTGAAAACTACAGTGTCGTCTCCTGGGTCCCCAAGGAG3120 AlaThrAlaGlyGluAsnTyrSerValValSerTrpValProLysGlu 1025103010351040 GGCCAGTGCAACTTCAGGTTCCATATCTTGTTCAAAGCCTTGGGAGAA3168 GlyGlnCysAsnPheArgPheHisIleLeuPheLysAlaLeuGlyGlu 104510501055 GAGAAGGGTGGGGCTTCCCTTTCGCCACAGTATGTCAGCTACAACCAG3216 GluLysGlyGlyAlaSerLeuSerProGlnTyrValSerTyrAsnGln 106010651070 AGCTCCTACACGCAGTGGGACCTGCAGCCTGACACTGACTACGAGATC3264 SerSerTyrThrGlnTrpAspLeuGlnProAspThrAspTyrGluIle 107510801085 CACTTGTTTAAGGAGAGGATGTTCCGGCACCAAATGGCTGTGAAGACC3312 HisLeuPheLysGluArgMetPheArgHisGlnMetAlaValLysThr 109010951100 AATGGCACAGGCCGCGTGAGGCTCCCTCCTGCTGGCTTCGCCACTGAG3360 AsnGlyThrGlyArgValArgLeuProProAlaGlyPheAlaThrGlu 1105111011151120 GGCTGGTTCATCGGCTTTGTGAGTGCCATCATCCTCCTGCTCCTCGTC3408 GlyTrpPheIleGlyPheValSerAlaIleIleLeuLeuLeuLeuVal 112511301135 CTGCTCATCCTCTGCTTCATCAAGCGCAGCAAGGGCGGCAAATACTCA3456 LeuLeuIleLeuCysPheIleLysArgSerLysGlyGlyLysTyrSer 114011451150 GTGAAGGATAAGGAGGACACCCAGGTGGACTCTGAGGCCCGACCGATG3504 ValLysAspLysGluAspThrGlnValAspSerGluAlaArgProMet 115511601165

AAAGATGAGACCTTCGGCGAGTACAGGTCCCTGGAGAGTGACAACGAG3552 LysAspGluThrPheGlyGluTyrArgSerLeuGluSerAspAsnGlu 117011751180 GAGAAGGCCTTTGGCAGCAGCCAGCCATCGCTCAACGGGGACATCAAG3600 GluLysAlaPheGlySerSerGlnProSerLeuAsnGlyAspIleLys 1185119011951200 CCCCTGGGCAGTGACGACAGCCTGGCCGATTATGGGGGCAGCGTGGAT3648 ProLeuGlySerAspAspSerLeuAlaAspTyrGlyGlySerValAsp 120512101215 GTTCAGTTCAACGAGGATGGTTCGTTCATTGGCCAGTACAGTGGCAAG3696 ValGlnPheAsnGluAspGlySerPheIleGlyGlnTyrSerGlyLys 122012251230 AAGGAGAAGGAGGCGGCAGGGGGCAATGACAGCTCAGGGGCCACTTCC3744 LysGluLysGluAlaAlaGlyGlyAsnAspSerSerGlyAlaThrSer 123512401245 CCCATCAACCCTGCCGTGGCCCTAGAATAG3774 ProIleAsnProAlaValAlaLeuGlu 12501255 (2) INFORMATION FOR SEQ ID NO: 2: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 50 (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: oligonucleotide (iii) HYPOTHETICAL: irrelevant (iv) ANTI-SENSE: no (vi) ORIGINAL SOURCE: (A) ORGANISM: mouse (x) SEQUENCE DESCRIPTION: SEQ ID NO: 2: GAGGACACCCAGGTGGACTCTGAGGCCCGACCGATGAAAGATGAGACCTT50 (2) INFORMATION FOR SEQ ID NO: 3: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 40 (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: oligonucleotide (iii) HYPOTHETICAL: irrelevant (iv) ANTI-SENSE: no (x) SEQUENCE DESCRIPTION: SEQ ID NO: 3: TGCCACGCCCACTTCCCAGGCACCAGGACCATCATTCAGA40 (2) INFORMATION FOR SEQ ID NO: 4: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 95 (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: amino acids (iii) HYPOTHETICAL: irrelevant (iv) ANTI-SENSE: no (vi) ORIGINAL SOURCE: (A) ORGANISM: mouse (B) INDIVIDUAL ISOLATE: 8 day old mouse brain (vii) IMMEDIATE SOURCE: (A) LIBRARY: lamda GT 10 and lamda GT11 (B) CLONE: synthesis of several clones (x) PUBLICATION INFORMATION: (A) AUTHORS: Moos, M. Tacke, R. Scherer, H. Teplow, D. Fruh, K. Schachner, M. (B) TITLE: Neural adhesion molecule L1 is a member of the immunoglobulin superfamily with binding domains similar to fibronectin (C) JOURNAL: NATURE (D) VOLUME: 334 (E) ISSUE: (F) PAGES: 701-703 (G) DATE: 1988 (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 4: ValIleThrGluGlnSerProArgArgLeuValValPheProThrAspAsp 151015 IleSerLeuLysCysGluAlaArgGlyArgProGlnValGluPheArgTrp 202530 ThrLysAspGlyIleHisPheLysProLysGluGluLeuGlyValValVal 35404550 HisGluAlaProTyrSerGlySerPheThrIleGluGlyAsnAsnSerPhe 556065 AlaGlnArgPheGlnGlyIleTyrArgCysTyrAlaSerAsnLysLeuGly 70758085 ThrAlaMetSerHisGluIleGlnLeuVal 9095 (2) INFORMATION FOR SEQ ID NO: 5: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 106 (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: amino acids (iii) HYPOTHETICAL: irrelevant (iv) ANTI-SENSE: no (vi) ORIGINAL SOURCE: (A) ORGANISM: mouse (B) INDIVIDUAL ISOLATE: 8 day old mouse brain (vii) IMMEDIATE SOURCE: (A) LIBRARY: lamda GT 10 and lamda GT11 (B) CLONE: synthesis of several clones (x) PUBLICATION INFORMATION: (A) AUTHORS: Moos, M. Tacke, R. Scherer, H. Teplow, D. Fruh, K. Schachner, M. (B) TITLE: Neural adhesion molecule L1 is a member of the immunoglobulin superfamily with binding domains similar to fibronectin (C) JOURNAL: NATURE (D) VOLUME: 334 (E) ISSUE: (F) PAGES: 701-703 (G) DATE: 1988 (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 5: AlaGluGlyAlaProLysTrpProLysGluThrValLysProValGluVal 151015 GluGluGlyGluSerValValLeuProCysAsnProProProSerAlaAla 202530 ProProArgIleTyrTrpMetAsnSerLysIlePheAspIleLysGlnAsp 35404550 GluArgValSerMetGlyGlnAsnGlyAspLeuTyrPheAlaAsnValLeu 556065 ThrSerAspAsnHisSerAspTyrIleCysAsnAlaHisPheProGlyThr 70758085 ArgThrIleIleGlnLysGluProIleAspLeuArgValLysProThrAsn 9095100 SerMetIleAsp 105 (2) INFORMATION FOR SEQ ID NO: 6: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 96 (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: amino acids (iii) HYPOTHETICAL: irrelevant (iv) ANTI-SENSE: no (vi) ORIGINAL SOURCE: (A) ORGANISM: mouse (B) INDIVIDUAL ISOLATE: 8 day old mouse brain (vii) IMMEDIATE SOURCE: (A) LIBRARY: lamda GT 10 and lamda GT11 (B) CLONE: synthesis of several clones (x) PUBLICATION INFORMATION: (A) AUTHORS: Moos, M. Tacke, R. Scherer, H. Teplow, D. Fruh, K. Schachner, M. (B) TITLE: Neural adhesion molecule L1 is a member of the immunoglobulin superfamily with binding domains similar to fibronectin (C) JOURNAL: NATURE (D) VOLUME: 334 (E) ISSUE: (F) PAGES: 701-703 (G) DATE: 1988 (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 6: ArgLysProArgLeuLeuPheProThrAsnSerSerSerArgLeuValAla 151015 LeuGlnGlyGlnSerLeuIleLeuGluCysIleAlaGluGlyPheProThr 202530 ProThrIleLysTrpLeuHisProSerAspProMetProThrAspArgVal 35404550 IleTyrGlnAsnHisAsnLysThrLeuGlnLeuLeuAsnValGlyGluGlu 556065 AspAspGlyGluTyrThrCysLeuAlaGluAsnSerLeuGlySerAlaArg 70758085 HisAlaTyrTyrValThrValGluAlaAlaPro 9095 (2) INFORMATION FOR SEQ ID NO: 7: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 92 (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: amino acids (iii) HYPOTHETICAL: irrelevant (iv) ANTI-SENSE: no (vi) ORIGINAL SOURCE: (A) ORGANISM: mouse (B) INDIVIDUAL ISOLATE: 8 day old mouse brain (vii) IMMEDIATE SOURCE: (A) LIBRARY: lamda GT 10 and lamda GT11 (B) CLONE: synthesis of several clones (x) PUBLICATION INFORMATION: (A) AUTHORS: Moos, M. Tacke, R. Scherer, H. Teplow, D. Fruh, K. Schachner, M. (B) TITLE: Neural adhesion molecule L1 is a member of the immunoglobulin superfamily with binding domains similar to fibronectin (C) JOURNAL: NATURE (D) VOLUME: 334 (E) ISSUE: (F) PAGES: 701-703 (G) DATE: 1988 (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 7: TyrTrpLeuGlnLysProGlnSerHisLeuTyrGlyProGlyGluThrAla 151015 ArgLeuAspCysGlnValGlnGlyArgProGlnProGluIleThrTrpArg 202530 IleAsnGlyMetSerMetGluThrValAsnLysAspGlnLysTyrArgIle 35404550 GluGlnGlySerLeuIleLeuSerAsnValGlnProThrAspThrMetVal 556065 ThrGlnCysGluAlaArgAsnGlnHisGlyLeuLeuLeuAlaAsnAlaTyr 70758085 IleTyrValValGlnLeuPro 90 (2) INFORMATION FOR SEQ ID NO: 8: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 93 (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: amino acids (iii) HYPOTHETICAL: irrelevant (iv) ANTI-SENSE: no (vi) ORIGINAL SOURCE: (A) ORGANISM: mouse (B) INDIVIDUAL ISOLATE: 8 day old mouse brain (vii) IMMEDIATE SOURCE: (A) LIBRARY: lamda GT 10 and lamda GT11 (B) CLONE: synthesis of several clones (x) PUBLICATION INFORMATION: (A) AUTHORS: Moos, M. Tacke, R. Scherer, H. Teplow, D. Fruh, K. Schachner, M. (B) TITLE: Neural adhesion molecule L1 is a member of the immunoglobulin superfamily with binding domains similar to fibronectin (C) JOURNAL: NATURE (D) VOLUME: 334 (E) ISSUE: (F) PAGES: 701-703 (G) DATE: 1988

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 8: AlaArgIleLeuThrLysAspAsnGlnThrTyrMetAlaValGluGlySer 151015 ThrAlaTyrLeuLeuCysLysAlaPheGlyAlaProValProSerValGln 202530 TrpLeuAspGluGluGlyThrThrValLeuGlnAspGluArgPhePhePro 35404550 TyrAlaAsnGlyThrLeuSerIleArgAspLeuGlnAlaAsnAspThrGly 556065 ArgTyrPheCysGlnAlaAlaAsnAspGlnAsnAsnValIleIleLeuAla 70758085 AsnLeuGlnValLysGluAlaThr 90 (2) INFORMATION FOR SEQ ID NO: 9: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 96 (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: amino acids (iii) HYPOTHETICAL: irrelevant (iv) ANTI-SENSE: no (vi) ORIGINAL SOURCE: (A) ORGANISM: mouse (B) INDIVIDUAL ISOLATE: 8 day old mouse brain (vii) IMMEDIATE SOURCE: (A) LIBRARY: lamda GT 10 and lamda GT11 (B) CLONE: synthesis of several clones (x) PUBLICATION INFORMATION: (A) AUTHORS: Moos, M. Tacke, R. Scherer, H. Teplow, D. Fruh, K. Schachner, M. (B) TITLE: Neural adhesion molecule L1 is a member of the immunoglobulin superfamily with binding domains similar to fibronectin (C) JOURNAL: NATURE (D) VOLUME: 334 (E) ISSUE: (F) PAGES: 701-703 (G) DATE: 1988 (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 9: GlnIleThrGlnGlyProArgSerAlaIleGluLysLysGlyAlaArgVal 151015 ThrPheThrCysGlnAlaSerPheAspProSerLeuGlnAlaSerIleThr 202530 TrpArgGlyAspGlyArgAspLeuGlnGluArgGlyAspSerAspLysTyr 35404550 PheIleGluAspGlyLysLeuValIleGlnSerLeuAspTyrSerAspGln 556065 GlyAsnTyrSerCysValAlaSerThrGluLeuAspGluValGluSerArg 70758085 AlaGlnLeuLeuValValGlySerProGlyPro 9095 (2) INFORMATION FOR SEQ ID NO: 10: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 101 (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: amino acids (iii) HYPOTHETICAL: irrelevant (iv) ANTI-SENSE: no (vi) ORIGINAL SOURCE: (A) ORGANISM: mouse (B) INDIVIDUAL ISOLATE: 8 day old mouse brain (vii) IMMEDIATE SOURCE: (A) LIBRARY: lamda GT 10 and lamda GT11 (B) CLONE: synthesis of several clones (x) PUBLICATION INFORMATION: (A) AUTHORS: Moos, M. Tacke, R. Scherer, H. Teplow, D. Fruh, K. Schachner, M. (B) TITLE: Neural adhesion molecule L1 is a member of the immunoglobulin superfamily with binding domains similar to fibronectin (C) JOURNAL: NATURE (D) VOLUME: 334 (E) ISSUE: (F) PAGES: 701-703 (G) DATE: 1988 (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 10: ValProHisLeuGluLeuSerAspArgHisLeuLeuLysGlnSerGlnVal 151015 HisLeuSerTrpSerProAlaGluAspHisAsnSerProIleGluLysTyr 202530 AspIleGluPheGluAspLysGluMetAlaProGluLysTrpPheSerLeu 35404550 GlyLysValProGlyAsnGlnThrSerThrThrLeuLysLeuSerProTyr 556065 ValHisTyrThrPheArgValThrAlaIleAsnLysTyrGlyProGlyGlu 70758085 ProSerProValSerGluSerValValThrProGluAlaAlaProGlu 9095100 (2) INFORMATION FOR SEQ ID NO: 11: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 96 (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: amino acids (iii) HYPOTHETICAL: irrelevant (iv) ANTI-SENSE: no (vi) ORIGINAL SOURCE: (A) ORGANISM: mouse (B) INDIVIDUAL ISOLATE: 8 day old mouse brain (vii) IMMEDIATE SOURCE: (A) LIBRARY: lamda GT 10 and lamda GT11

(B) CLONE: synthesis of several clones (x) PUBLICATION INFORMATION: (A) AUTHORS: Moos, M. Tacke, R. Scherer, H. Teplow, D. Fruh, K. Schachner, M. (B) TITLE: Neural adhesion molecule L1 is a member of the immunoglobulin superfamily with binding domains similar to fibronectin (C) JOURNAL: NATURE (D) VOLUME: 334 (E) ISSUE: (F) PAGES: 701-703 (G) DATE: 1988 (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 11: LysAsnProValAspValArgGlyGluGlyAsnGluThrAsnAsnMetVal 151015 IleThrTrpLysProLeuArgTrpMetAspTrpAsnAlaProGlnIleGln 202530 TyrArgValGlnTrpArgProGlnGlyLysGlnGluThrTrpArgLysGln 35404550 ThrValSerAspProPheLeuValValSerAsnThrSerThrPheValPro 556065 TyrGluIleLysValGlnAlaValAsnAsnGlnGlyLysGlyProGluPro 70758085 GlnValThrIleGlyTyrSerGlyGluAspTyr 9095 (2) INFORMATION FOR SEQ ID NO: 12: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 106 (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: amino acids (iii) HYPOTHETICAL: irrelevant (iv) ANTI-SENSE: no (vi) ORIGINAL SOURCE: (A) ORGANISM: mouse (B) INDIVIDUAL ISOLATE: 8 day old mouse brain (vii) IMMEDIATE SOURCE: (A) LIBRARY: lamda GT 10 and lamda GT11 (B) CLONE: synthesis of several clones (x) PUBLICATION INFORMATION: (A) AUTHORS: Moos, M. Tacke, R. Scherer, H. Teplow, D. Fruh, K. Schachner, M. (B) TITLE: Neural adhesion molecule L1 is a member of the immunoglobulin superfamily with binding domains similar to fibronectin (C) JOURNAL: NATURE (D) VOLUME: 334 (E) ISSUE: (F) PAGES: 701-703 (G) DATE: 1988 (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 12: ProGlnValSerProGluLeuGluAspIleThrIlePheAsnSerSerThr 151015 ValLeuValArgTrpArgProValAspLeuAlaGlnValLysGlyHisLeu 202530 LysGlyTyrAsnValThrTyrTrpTrpLysGlySerGlnArgLysHisSer 35404550 LysArgHisIleHisLysSerHisIleValValProAlaAsnThrThrSer 556065 AlaIleLeuSerGlyLeuArgProTyrSerSerTyrHisValGluValGln 70758085 AlaPheAsnGlyArgGlyLeuGlyProAlaSerGluTrpThrPheSerThr 9095100 ProGluGlyVal 105 (2) INFORMATION FOR SEQ ID NO: 13: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 98 (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: amino acids (iii) HYPOTHETICAL: irrelevant (iv) ANTI-SENSE: no (vi) ORIGINAL SOURCE: (A) ORGANISM: mouse (B) INDIVIDUAL ISOLATE: 8 day old mouse brain (vii) IMMEDIATE SOURCE: (A) LIBRARY: lamda GT 10 and lamda GT11 (B) CLONE: synthesis of several clones (x) PUBLICATION INFORMATION: (A) AUTHORS: Moos, M. Tacke, R. Scherer, H. Teplow, D. Fruh, K. Schachner, M. (B) TITLE: Neural adhesion molecule L1 is a member of the immunoglobulin superfamily with binding domains similar to fibronectin (C) JOURNAL: NATURE (D) VOLUME: 334 (E) ISSUE: (F) PAGES: 701-703 (G) DATE: 1988 (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 13: ProGlyHisProGluAlaLeuHisLeuGluCysGlnSerAspThrSerLeu 151015 LeuLeuHisTrpGlnProProLeuSerHisAsnGlyValLeuThrGlyTyr 202530 LeuLeuSerTyrHisProValGluGlyGluSerLysGluGlnLeuPhePhe 35404550 AsnLeuSerAspProGluLeuArgThrHisAsnLeuThrAsnLeuAsnPro 556065 AspLeuGlnTyrArgPheGlnLeuGlnAlaThrThrGlnGlnGlyGlyPro 70758085 GlyGluAlaIleValArgGluGlyGlyThrMetAlaLeu 9095 (2) INFORMATION FOR SEQ ID NO: 14: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 101 (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: amino acids (iii) HYPOTHETICAL: irrelevant (iv) ANTI-SENSE: no (vi) ORIGINAL SOURCE: (A) ORGANISM: mouse (B) INDIVIDUAL ISOLATE: 8 day old mouse brain (vii) IMMEDIATE SOURCE: (A) LIBRARY: lamda GT 10 and lamda GT11 (B) CLONE: synthesis of several clones (x) PUBLICATION INFORMATION: (A) AUTHORS: Moos, M. Tacke, R. Scherer, H. Teplow, D. Fruh, K. Schachner, M. (B) TITLE: Neural adhesion molecule L1 is a member of the immunoglobulin superfamily with binding domains similar to fibronectin (C) JOURNAL: NATURE (D) VOLUME: 334 (E) ISSUE: (F) PAGES: 701-703 (G) DATE: 1988 (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 14: PheGlyLysProAspPheGlyAsnIleSerAlaThrAlaGlyGluAsnTyr 151015 SerValValSerTrpValProArgLysGlyGlnCysAsnPheArgPheHis 202530 IleLeuPheLysAlaLeuProGluGlyLysValSerProAspHisGlnPro 35404550 GlnProGlnTyrValSerTyrAsnGlnSerSerTyrThrGlnTrpAsnLeu 556065 GlnProAspThrLysTyrGluIleHisLeuIleLysGluLysValLeuLeu 70758085 HisHisLeuAspValLysThrAsnGlyThrGlyProValArgValSer 9095100 (2) INFORMATION FOR SEQ ID NO: 15: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 145 (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: amino acids (iii) HYPOTHETICAL: irrelevant (iv) ANTI-SENSE: no (vi) ORIGINAL SOURCE: (A) ORGANISM: mouse (B) INDIVIDUAL ISOLATE: 8 day old mouse brain (vii) IMMEDIATE SOURCE: (A) LIBRARY: lamda GT 10 and lamda GT11 (B) CLONE: synthesis of several clones (x) PUBLICATION INFORMATION: (A) AUTHORS: Moos, M. Tacke, R. Scherer, H. Teplow, D. Fruh, K. Schachner, M. (B) TITLE: Neural adhesion molecule L1 is a member of the immunoglobulin superfamily with binding domains similar to fibronectin (C) JOURNAL: NATURE (D) VOLUME: 334 (E) ISSUE: (F) PAGES: 701-703 (G) DATE: 1988 (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 15: ThrThrGlySerPheAlaSerGluGlyTrpPheIleAlaPheValSerAla 151015 IleIleLeuLeuLeuLeuIleLeuLeuIleLeuCysPheIleLysArgSer 202530 LysGlyGlyLysTyrSerValLysAspLysGluAspThrGlnValAspSer 35404550 GluAlaArgProMetLysAspGluThrPheGlyGluTyrArgSerLeuGlu 556065 SerAspAsnGluGluLysAlaPheGlySerSerGlnProSerLeuAsnGly 70758085 AspIleLysProLeuGlySerAspAspSerLeuAlaAspTyrGlyGlySer 9095100 ValAspValGlnPheAsnGluAspGlySerPheIleGlyGlnTyrSerGly 105110115 LysLysGluLysGluAlaAlaGlyGlyAsnAspSerSerGlyAlaThrSer 120125130135 ProIleAsnProAlaValAlaLeuGlu 140145 (2) INFORMATION FOR SEQ ID NO:16: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 96 (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: amino acids (iii) HYPOTHETICAL: irrelevant (iv) ANTI-SENSE: no (vi) ORIGINAL SOURCE: (A) ORGANISM: Homo Sapiens (B) INDIVIDUAL ISOLATE: 17-18 week fetus (vii) IMMEDIATE SOURCE: (A) LIBRARY: Stratagene cDNA Library 936206 (B) CLONE: synthesis of 4 clones (x) PUBLICATION INFORMATION: (A) AUTHORS: Hlavin, Mary Louise Lemmon, Vance (B) TITLE: Molecular structure and functional testing of human L1CAM: an interspecies comparison. (C) JOURNAL: GENOMICS (D) VOLUME: 11 (E) ISSUE: (F) PAGES: 416-423 (G) DATE: 1991 (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 16: ValIleThrGluGlnSerProArgArgLeuValValPheProThrAspAsp 151015 IleSerLeuLysCysGluAlaSerGlyLysProGluValGlnPheArgTrp 202530 ThrArgAspGlyValHisPheLysProLysGluGluLeuGlyValThrVal 35404550 TyrGlnSerProHisSerGlySerPheThrIleThrGlyAsnAsnSerAsn 556065 PheAlaGlnArgPheGlnGlyIleTyrArgCysPheAlaSerAsnLysLeu 70758085

GlyThrAlaMetSerHisGluIleArgLeuMet 9095 (2) INFORMATION FOR SEQ ID NO:17: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 106 (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: amino acids (iii) HYPOTHETICAL: irrelevant (iv) ANTI-SENSE: no (vi) ORIGINAL SOURCE: (A) ORGANISM: Homo Sapiens (B) INDIVIDUAL ISOLATE: 17-18 week fetus (vii) IMMEDIATE SOURCE: (A) LIBRARY: Stratagene cDNA Library 936206 (B) CLONE: synthesis of 4 clones (x) PUBLICATION INFORMATION: (A) AUTHORS: Hlavin, Mary Louise Lemmon, Vance (B) TITLE: Molecular structure and functional testing of human L1CAM: an interspecies comparison. (C) JOURNAL: GENOMICS (D) VOLUME: 11 (E) ISSUE: (F) PAGES: 416-423 (G) DATE: 1991 (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 17: AlaGluGlyAlaProLysTrpProLysGluThrValLysProValGluVal 151015 GluGluGlyGluSerValValLeuProCysAsnProProProSerAlaGlu 202530 ProLeuArgIleTyrTrpMetAsnSerLysIleLeuHisIleLysGlnAsp 35404550 GluArgValThrMetGlyGlnAsnGlyAsnLeuTyrPheAlaAsnValLeu 556065 ThrSerAspAsnHisSerAspTyrIleCysHisAlaHisPheProGlyThr 70758085 ArgThrIleIleGlnLysGluProIleAspLeuArgValLysAlaThrAsn 9095100 SerMetIleAsp 105 (2) INFORMATION FOR SEQ ID NO:18: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 96 (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: amino acids (iii) HYPOTHETICAL: irrelevant (iv) ANTI-SENSE: no (vi) ORIGINAL SOURCE: (A) ORGANISM: Homo Sapiens (B) INDIVIDUAL ISOLATE: 17-18 week fetus (vii) IMMEDIATE SOURCE: (A) LIBRARY: Stratagene cDNA Library 936206 (B) CLONE: synthesis of 4 clones (x) PUBLICATION INFORMATION: (A) AUTHORS: Hlavin, Mary Louise Lemmon, Vance (B) TITLE: Molecular structure and functional testing of human L1CAM: an interspecies comparison. (C) JOURNAL: GENOMICS (D) VOLUME: 11 (E) ISSUE: (F) PAGES: 416-423 (G) DATE: 1991 (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 18: ArgLysProArgLeuLeuPheProThrAsnSerSerSerHisLeuValAla 151015 LeuGlnGlyGlnProLeuValLeuGluCysIleAlaGluGlyPheProThr 202530 ProThrIleLysTrpLeuArgProSerGlyProMetProAlaAspArgVal 35404550 ThrTyrGlnAsnHisAsnLysThrLeuGlnLeuLeuLysValGlyGluGlu 556065 AspAspGlyGluTyrArgCysLeuAlaGluAsnSerLeuGlySerAlaArg 70758085 HisAlaTyrTyrValThrValGluAlaAlaPro 9095 (2) INFORMATION FOR SEQ ID NO:19: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 92 (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: amino acids (iii) HYPOTHETICAL: irrelevant (iv) ANTI-SENSE: no (vi) ORIGINAL SOURCE: (A) ORGANISM: Homo Sapiens (B) INDIVIDUAL ISOLATE: 17-18 week fetus (vii) IMMEDIATE SOURCE: (A) LIBRARY: Stratagene cDNA Library 936206 (B) CLONE: synthesis of 4 clones (x) PUBLICATION INFORMATION: (A) AUTHORS: Hlavin, Mary Louise Lemmon, Vance (B) TITLE: Molecular structure and functional testing of human L1CAM: an interspecies comparison. (C) JOURNAL: GENOMICS (D) VOLUME: 11 (E) ISSUE: (F) PAGES: 416-423 (G) DATE: 1991 (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 19: TyrTrpLeuHisLysProGlnSerHisLeuTyrGlyProGlyGluThrAla 151015 ArgLeuAspCysGlnValGlnGlyArgProGlnProGluValThrTrpArg 202530 IleAsnGlyIleProValGluGluLeuAlaLysAspGlnLysTyrArgIle 35404550 GlnArgGlyAlaLeuIleLeuSerAsnValGlnProSerAspThrMetVal 556065 ThrGlnCysGluAlaArgAsnArgHisGlyLeuLeuLeuAlaAsnAlaTyr 70758085 IleTyrValValGlnLeuPro 90 (2) INFORMATION FOR SEQ ID NO:20: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 93 (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: amino acids (iii) HYPOTHETICAL: irrelevant (iv) ANTI-SENSE: no (vi) ORIGINAL SOURCE: (A) ORGANISM: Homo Sapiens (B) INDIVIDUAL ISOLATE: 17-18 week fetus (vii) IMMEDIATE SOURCE: (A) LIBRARY: Stratagene cDNA Library 936206 (B) CLONE: synthesis of 4 clones (x) PUBLICATION INFORMATION: (A) AUTHORS: Hlavin, Mary Louise Lemmon, Vance (B) TITLE: Molecular structure and functional testing of human L1CAM: an interspecies comparison. (C) JOURNAL: GENOMICS (D) VOLUME: 11 (E) ISSUE: (F) PAGES: 416-423 (G) DATE: 1991 (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 20: AlaLysIleLeuThrAlaAspAsnGlnThrTyrMetAlaValGlnGlySer 151015 ThrAlaTyrLeuLeuCysLysAlaPheGlyAlaProValProSerValGln 202530 TrpLeuAspGluAspGlyThrThrValLeuGlnAspGluArgPhePhePro 35404550 TyrAlaAsnGlyThrLeuGlyIleArgAspLeuGlnAlaAsnAspThrGly 556065 ArgTyrPheCysLeuAlaAlaAsnAspGlnAsnAsnValThrIleMetAla 70758085 AsnLeuLysValLysAspAlaThr 90 (2) INFORMATION FOR SEQ ID NO:21: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 96 (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: amino acids (iii) HYPOTHETICAL: irrelevant (iv) ANTI-SENSE: no (vi) ORIGINAL SOURCE: (A) ORGANISM: Homo Sapiens (B) INDIVIDUAL ISOLATE: 17-18 week fetus (vii) IMMEDIATE SOURCE: (A) LIBRARY: Stratagene cDNA Library 936206 (B) CLONE: synthesis of 4 clones (x) PUBLICATION INFORMATION: (A) AUTHORS: Hlavin, Mary Louise Lemmon, Vance (B) TITLE: Molecular structure and functional testing of human L1CAM: an interspecies comparison. (C) JOURNAL: GENOMICS (D) VOLUME: 11 (E) ISSUE: (F) PAGES: 416-423 (G) DATE: 1991 (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 21: GlnIleThrGlnGlyProArgSerThrIleGluLysLysGlySerArgVal 151015 ThrPheThrCysGlnAlaSerPheAspProSerLeuGlnProSerIleThr 202530 TrpArgGlyAspGlyArgAspLeuGlnGluLeuGlyAspSerAspLysTyr 35404550 PheIleGluAspGlyArgLeuValIleHisSerLeuAspTyrSerAspGln 556065 GlyAsnTyrSerCysValAlaSerThrGluLeuAspValValGluSerArg 70758085 AlaGlnLeuLeuValValGlySerProGlyPro 9095 (2) INFORMATION FOR SEQ ID NO:22: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 101 (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: amino acids (iii) HYPOTHETICAL: irrelevant (iv) ANTI-SENSE: no (vi) ORIGINAL SOURCE: (A) ORGANISM: Homo Sapiens (B) INDIVIDUAL ISOLATE: 17-18 week fetus (vii) IMMEDIATE SOURCE: (A) LIBRARY: Stratagene cDNA Library 936206 (B) CLONE: synthesis of 4 clones (x) PUBLICATION INFORMATION: (A) AUTHORS: Hlavin, Mary Louise Lemmon, Vance (B) TITLE: Molecular structure and functional testing of human L1CAM: an interspecies comparison. (C) JOURNAL: GENOMICS (D) VOLUME: 11 (E) ISSUE: (F) PAGES: 416-423 (G) DATE: 1991 (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 22: ValProArgLeuValLeuSerAspLeuHisLeuLeuThrGlnSerGlnVal 151015 ArgValSerTrpSerProAlaGluAspHisAsnAlaProIleGluLysTyr 202530 AspIleGluPheGluAspLysGluMetAlaProGluLysTrpTyrSerLeu 35404550 GlyLysValProGlyAsnGlnThrSerThrThrLeuLysLeuSerProTyr 556065 ValHisTyrThrPheArgValThrAlaIleAsnLysTyrGlyProGlyGlu 70758085 ProSerProValSerGluThrValValThrProGluAlaAlaProGlu 9095100 (2) INFORMATION FOR SEQ ID NO:23: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 96 (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: amino acids (iii) HYPOTHETICAL: irrelevant (iv) ANTI-SENSE: no (vi) ORIGINAL SOURCE: (A) ORGANISM: Homo Sapiens (B) INDIVIDUAL ISOLATE: 17-18 week fetus (vii) IMMEDIATE SOURCE:

(A) LIBRARY: Stratagene cDNA Library 936206 (B) CLONE: synthesis of 4 clones (x) PUBLICATION INFORMATION: (A) AUTHORS: Hlavin, Mary Louise Lemmon, Vance (B) TITLE: Molecular structure and functional testing of human L1CAM: an interspecies comparison. (C) JOURNAL: GENOMICS (D) VOLUME: 11 (E) ISSUE: (F) PAGES: 416-423 (G) DATE: 1991 (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 23: LysAsnProValAspValLysGlyGluGlyAsnGluThrThrAsnMetVal 151015 IleThrTrpLysProLeuArgTrpMetAspTrpAsnAlaProGlnValGln 202530 TyrArgValGlnTrpArgProGlnGlyThrArgGlyProTrpGlnGluGln 35404550 IleValSerAspProPheLeuValValSerAsnThrSerThrPheValPro 556065 TyrGluIleLysValGlnAlaValAsnSerGlnGlyLysGlyProGluPro 70758085 GlnValThrIleGlyTyrSerGlyGluAspTyr 9095 (2) INFORMATION FOR SEQ ID NO:24: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 106 (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: amino acids (iii) HYPOTHETICAL: irrelevant (iv) ANTI-SENSE: no (vi) ORIGINAL SOURCE: (A) ORGANISM: Homo Sapiens (B) INDIVIDUAL ISOLATE: 17-18 week fetus (vii) IMMEDIATE SOURCE: (A) LIBRARY: Stratagene cDNA Library 936206 (B) CLONE: synthesis of 4 clones (x) PUBLICATION INFORMATION: (A) AUTHORS: Hlavin, Mary Louise Lemmon, Vance (B) TITLE: Molecular structure and functional testing of human L1CAM: an interspecies comparison. (C) JOURNAL: GENOMICS (D) VOLUME: 11 (E) ISSUE: (F) PAGES: 416-423 (G) DATE: 1991 (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 24: ProGlnAlaIleProGluLeuGluGlyIleGluIleLeuAsnSerSerAla 151015 ValLeuValLysTrpArgProValAspLeuAlaGlnValLysGlyHisLeu 202530 ArgGlyTyrAsnValThrTyrTrpArgGluGlySerGlnArgLysHisSer 35404550 LysArgHisIleHisLysAspHisValValValProAlaAsnThrThrSer 556065 ValIleLeuSerGlyLeuArgProTyrSerSerTyrHisLeuGluValGln 70758085 AlaPheAsnGlyArgGlySerGlyProAlaSerGluPheThrPheSerThr 9095100 ProGluGlyVal 105 (2) INFORMATION FOR SEQ ID NO:25: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 97 (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: amino acids (iii) HYPOTHETICAL: irrelevant (iv) ANTI-SENSE: no (vi) ORIGINAL SOURCE: (A) ORGANISM: Homo Sapiens (B) INDIVIDUAL ISOLATE: 17-18 week fetus (vii) IMMEDIATE SOURCE: (A) LIBRARY: Stratagene cDNA Library 936206 (B) CLONE: synthesis of 4 clones (x) PUBLICATION INFORMATION: (A) AUTHORS: Hlavin, Mary Louise Lemmon, Vance (B) TITLE: Molecular structure and functional testing of human L1CAM: an interspecies comparison. (C) JOURNAL: GENOMICS (D) VOLUME: 11 (E) ISSUE: (F) PAGES: 416-423 (G) DATE: 1991 (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 25: ProGlyHisProGluAlaLeuHisLeuGluCysGlnSerAsnThrSerLeu 151015 LeuLeuArgTrpGlnProProLeuSerHisAsnGlyValLeuThrGlyTyr 202530 ValLeuSerTyrHisProLeuAspGluGlyGlyLysGlyGlnLeuSerPhe 35404550 AsnLeuArgAspProGluLeuArgThrHisAsnLeuThrAspLeuSerPro 556065 HisLeuArgTyrArgPheGlnLeuGlnAlaThrThrLysGluGlyProGly 70758085 GluAlaIleValArgGluGlyGlyThrMetAlaLeu 9095 (2) INFORMATION FOR SEQ ID NO:26: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 99 (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: amino acids (iii) HYPOTHETICAL: irrelevant (iv) ANTI-SENSE: no (vi) ORIGINAL SOURCE:

(A) ORGANISM: Homo Sapiens (B) INDIVIDUAL ISOLATE: 17-18 week fetus (vii) IMMEDIATE SOURCE: (A) LIBRARY: Stratagene cDNA Library 936206 (B) CLONE: synthesis of 4 clones (x) PUBLICATION INFORMATION: (A) AUTHORS: Hlavin, Mary Louise Lemmon, Vance (B) TITLE: Molecular structure and functional testing of human L1CAM: an interspecies comparison. (C) JOURNAL: GENOMICS (D) VOLUME: 11 (E) ISSUE: (F) PAGES: 416-423 (G) DATE: 1991 (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 26: SerGlyIleSerAspPheGlyAsnIleSerAlaThrAlaGlyGluAsnTyr 151015 SerValValSerTrpValProLysGluGlyGlnCysAsnPheArgPheHis 202530 IleLeuPheLysAlaLeuGlyGluGluLysGlyGlyAlaSerLeuSerPro 35404550 GlnTyrValSerTyrAsnGlnSerSerTyrThrGlnTrpAspLeuGlnPro 556065 AspThrAspTyrGluIleHisLeuPheLysGluArgMetPheArgHisGln 70758085 MetAlaValLysThrAsnGlyThrGlyArgValArgLeuPro 9095 (2) INFORMATION FOR SEQ ID NO: 27: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 144 (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: amino acids (iii) HYPOTHETICAL: irrelevant (iv) ANTI-SENSE: no (vi) ORIGINAL SOURCE: (A) ORGANISM: Homo Sapiens (B) INDIVIDUAL ISOLATE: 17-18 week fetus (vii) IMMEDIATE SOURCE: (A) LIBRARY: Stratagene cDNA Library 936206 (B) CLONE: synthesis of 4 clones (x) PUBLICATION INFORMATION: (A) AUTHORS: Hlavin, Mary Louise Lemmon, Vance (B) TITLE: Molecular structure and functional testing of human L1CAM: an interspecies comparison. (C) JOURNAL: GENOMICS (D) VOLUME: 11 (E) ISSUE: (F) PAGES: 416-423 (G) DATE: 1991 (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 27: ProAlaGlyPheAlaThrGluGlyTrpPheIleGlyPheValSerAlaIle 151015 IleLeuLeuLeuLeuValLeuLeuIleLeuCysPheIleLysArgSerLys 202530 GlyGlyLysTyrSerValLysAspLysGluAspThrGlnValAspSerGlu 35404550 AlaArgProMetLysAspGluThrPheGlyGluTyrArgSerLeuGluSer 556065 AspAsnGluGluLysAlaPheGlySerSerGlnProSerLeuAsnGlyAsp 70758085 IleLysProLeuGlySerAspAspSerLeuAlaAspTyrGlyGlySerVal 9095100 AspValGlnPheAsnGluAspGlySerPheIleGlyGlnTyrSerGlyLys 105110115 LysGluLysGluAlaAlaGlyGlyAsnAspSerSerGlyAlaThrSerPro 120125130135 IleAsnProAlaValAlaLeuGlu 140 (2) INFORMATION FOR SEQ ID NO:28: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 90 (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: amino acids (iii) HYPOTHETICAL: irrelevant (iv) ANTI-SENSE: no (vi) ORIGINAL SOURCE: (A) ORGANISM: CHICKEN (B) INDIVIDUAL ISOLATE: e9-e14 embryos brains, adult brains (vii) IMMEDIATE SOURCE: (A) LIBRARY: many lambda GT11 cDNA and genomic libraries (B) CLONE: synthesis of 14 clones (x) PUBLICATION INFORMATION: (A) AUTHORS: Burgoon, M.P. Grumet, M. Mauro, V. Edelman, G.M. Cunningham, B.A. (B) TITLE: Structure of the chicken neuron- glial cell adhesion molecule, Ng-CAM: Origin of the polypeptides and relation to the Ig superfamily. (C) JOURNAL: J. Cell Biol. (D) VOLUME: 112 (E) ISSUE: (F) PAGES: 1017-1029 (G) DATE: 1991 (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 28: GluLeuThrGluGluProProGluGlnLeuValValPheProSerAspAsp 151015 IleValLeuLysCysValAlaThrGlyAsnProProValGlnTyrArgTrp 202530 SerArgGluIleSerProSerSerProArgSerThrGlyGlySerArgTrp 35404550 SerProAspArgHisLeuValIleAsnAlaThrLeuAlaAlaArgLeuGln 556065 GlyArgPheArgCysPheAlaThrAsnAlaLeuGlyThrAlaValSerPro 70758085 GluAlaAsnValIle 90 (2) INFORMATION FOR SEQ ID NO:29: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 106 (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: amino acids (iii) HYPOTHETICAL: irrelevant (iv) ANTI-SENSE: no (vi) ORIGINAL SOURCE: (A) ORGANISM: CHICKEN (B) INDIVIDUAL ISOLATE: e9-e14 embryos brains, adult brains (vii) IMMEDIATE SOURCE: (A) LIBRARY: many lambda GT11 cDNA and genomic libraries (B) CLONE: synthesis of 14 clones (x) PUBLICATION INFORMATION: (A) AUTHORS: Burgoon, M.P. Grumet, M. Mauro, V. Edelman, G.M. Cunningham, B.A. (B) TITLE: Structure of the chicken neuron- glial cell adhesion molecule, Ng-CAM: Origin of the polypeptides and relation to the Ig superfamily. (C) JOURNAL: J. Cell Biol. (D) VOLUME: 112 (E) ISSUE: (F) PAGES: 1017-1029 (G) DATE: 1991 (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 29: AlaGluAsnThrProGlnTrpProLysLysLysValThrProValGluVal 151015 GluGluGlyAspProValValLeuProCysAspProProGluSerAlaVal 202530 ProProLysIleTyrTrpLeuAsnSerAspIleValHisIleAlaGlnAsp 35404550 GluArgValSerMetGlyGlnAspGlyAsnLeuTyrPheSerAsnAlaMet 556065 ValGlyAspSerHisProAspTyrIleCysHisAlaHisPheLeuGlyPro 70758085 ArgThrIleIleGlnLysGluProLeuAspLeuArgValAlaProSerAsn 9095100 AlaValArgSer 105 (2) INFORMATION FOR SEQ ID NO: 30: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 94 (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: amino acids (iii) HYPOTHETICAL: irrelevant (iv) ANTI-SENSE: no (vi) ORIGINAL SOURCE: (A) ORGANISM: CHICKEN (B) INDIVIDUAL ISOLATE: e9-e14 embryos brains, adult brains (vii) IMMEDIATE SOURCE: (A) LIBRARY: many lambda GT11 cDNA and genomic libraries (B) CLONE: synthesis of 14 clones (x) PUBLICATION INFORMATION: (A) AUTHORS: Burgoon, M.P. Grumet, M. Mauro, V. Edelman, G.M. Cunningham, B.A. (B) TITLE: Structure of the chicken neuron- glial cell adhesion molecule, Ng-CAM: Origin of the polypeptides and relation to the Ig superfamily. (C) JOURNAL: J. Cell Biol. (D) VOLUME: 112 (E) ISSUE: (F) PAGES: 1017-1029 (G) DATE: 1991 (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 30: ArgArgProArgLeuLeuLeuProArgAspProGlnThrThrThrIleAla 151015 LeuArgGlyGlySerValValLeuGluCysIleAlaGluGlyLeuProThr 202530 ProTrpValArgTrpArgArgLeuAsnGlyProLeuLeuProGlyGlyVal 35404550 GlyAsnPheAsnLysThrLeuArgLeuTrpGlyValThrGluSerAspAsp 556065 GlyGluTyrGluCysValAlaGluAsnGlyArgGlyThrAlaArgGlyThr 70758085 HisSerValThrValGluAlaAlaPro 90 (2) INFORMATION FOR SEQ ID NO:31: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 91 (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: amino acids (iii) HYPOTHETICAL: irrelevant (iv) ANTI-SENSE: no (vi) ORIGINAL SOURCE: (A) ORGANISM: CHICKEN (B) INDIVIDUAL ISOLATE: e9-e14 embryos brains, adult brains (vii) IMMEDIATE SOURCE: (A) LIBRARY: many lambda GT11 cDNA and genomic libraries (B) CLONE: synthesis of 14 clones (x) PUBLICATION INFORMATION: (A) AUTHORS: Burgoon, M.P. Grumet, M. Mauro, V. Edelman, G.M. Cunningham, B.A. (B) TITLE: Structure of the chicken neuron- glial cell adhesion molecule, Ng-CAM: Origin of the polypeptides and relation to the Ig superfamily. (C) JOURNAL: J. Cell Biol. (D) VOLUME: 112 (E) ISSUE: (F) PAGES: 1017-1029 (G) DATE: 1991 (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 31: TyrTrpValArgArgProGlnSerGlyValPheGlyProGlyGluThrAla 151015 ArgLeuAspCysGluValGlyGlyLysProArgProGlnIleGlnTrpSer 202530 IleAsnGlyValProIleGluAlaAlaGlyAlaGluArgArgTrpLeuArg 35404550 GlyGlyAlaLeuValLeuProGluLeuArgProAsnAspSerAlaValLeu 556065 GlnCysGluAlaArgAsnArgHisGlyProLeuLeuAlaAsnAlaPheLeu 70758085 HisValValGluLeuPro 90 (2) INFORMATION FOR SEQ ID NO:32: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 93

(B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: amino acids (iii) HYPOTHETICAL: irrelevant (iv) ANTI-SENSE: no (vi) ORIGINAL SOURCE: (A) ORGANISM: CHICKEN (B) INDIVIDUAL ISOLATE: e9-e14 embryos brains, adult brains (vii) IMMEDIATE SOURCE: (A) LIBRARY: many lambda GT11 cDNA and genomic libraries (B) CLONE: synthesis of 14 clones (x) PUBLICATION INFORMATION: (A) AUTHORS: Burgoon, M.P. Grumet, M. Mauro, V. Edelman, G.M. Cunningham, B.A. (B) TITLE: Structure of the chicken neuron- glial cell adhesion molecule, Ng-CAM: Origin of the polypeptides and relation to the Ig superfamily. (C) JOURNAL: J. Cell Biol. (D) VOLUME: 112 (E) ISSUE: (F) PAGES: 1017-1029 (G) DATE: 1991 (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 32: LeuArgMetLeuThrAlaAspGluGlnArgTyrGluValValGluAsnGln 151015 ThrValPheLeuHisCysArgThrPheGlyAlaProAlaProAsnValGlu 202530 TrpLeuThrProThrLeuGluProAlaLeuGlnAspAspArgSerPheVal 35404550 PheThrAsnGlySerLeuArgValSerAlaValArgGlyGlyAspGlyGly 556065 ValTyrThrCysMetAlaGlnAsnAlaHisSerAsnGlySerLeuThrAla 70758085 LeuLeuGluValArgAlaProThr 90 (2) INFORMATION FOR SEQ ID NO:33: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 92 (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: amino acids (iii) HYPOTHETICAL: irrelevant (iv) ANTI-SENSE: no (vi) ORIGINAL SOURCE: (A) ORGANISM: CHICKEN (B) INDIVIDUAL ISOLATE: e9-e14 embryos brains, adult brains (vii) IMMEDIATE SOURCE: (A) LIBRARY: many lambda GT11 cDNA and genomic libraries (B) CLONE: synthesis of 14 clones (x) PUBLICATION INFORMATION: (A) AUTHORS: Burgoon, M.P. Grumet, M. Mauro, V. Edelman, G.M. Cunningham, B.A. (B) TITLE: Structure of the chicken neuron- glial cell adhesion molecule, Ng-CAM: Origin of the polypeptides and relation to the Ig superfamily. (C) JOURNAL: J. Cell Biol. (D) VOLUME: 112 (E) ISSUE: (F) PAGES: 1017-1029 (G) DATE: 1991 (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 33: ArgIleSerAlaProProArgSerAlaThrAlaLysLysGlyGluThrVal 151015 ThrPheHisCysGlyAlaThrPheAspProAlaValThrProGlyGluLeu 202530 ArgTrpLeuArgGlyGlyGlnProLeuProAspAspProArgTyrSerVal 35404550 AlaAlaGluMetThrValSerAsnValAspTyrGlyAspGluGlyThrIle 556065 GlnCysArgAlaSerThrProLeuAspSerAlaGluAlaGluAlaGlnLeu 70758085 ArgValValGlyArgProPro 90 (2) INFORMATION FOR SEQ ID NO:34: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 98 (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: amino acids (iii) HYPOTHETICAL: irrelevant (iv) ANTI-SENSE: no (vi) ORIGINAL SOURCE: (A) ORGANISM: CHICKEN (B) INDIVIDUAL ISOLATE: e9-e14 embryos brains, adult brains (vii) IMMEDIATE SOURCE: (A) LIBRARY: many lambda GT11 cDNA and genomic libraries (B) CLONE: synthesis of 14 clones (x) PUBLICATION INFORMATION: (A) AUTHORS: Burgoon, M.P. Grumet, M. Mauro, V. Edelman, G.M. Cunningham, B.A. (B) TITLE: Structure of the chicken neuron- glial cell adhesion molecule, Ng-CAM: Origin of the polypeptides and relation to the Ig superfamily. (C) JOURNAL: J. Cell Biol. (D) VOLUME: 112 (E) ISSUE: (F) PAGES: 1017-1029 (G) DATE: 1991 (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 34: SerArgAspLeuGlnValMetGluValAspGluHisArgValArgLeuSer 151015 TrpThrProGlyAspAspHisAsnSerProIleGluLysPheValValGlu 202530 GluGluGluGluArgGluAspLeuGlnArgGlyPheGlyAlaAlaAspVal 35404550 ProGlyGlnProTrpThrProProLeuProLeuSerProTyrGlyArgPhe 556065 ProPheArgValValAlaValAsnAlaTyrGlyArgGlyGluHisHisAla 70758085 ProSerAlaProIleGluThrProProAlaAlaProGlu 9095 (2) INFORMATION FOR SEQ ID NO:35: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 104 (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: amino acids (iii) HYPOTHETICAL: irrelevant (iv) ANTI-SENSE: no (vi) ORIGINAL SOURCE: (A) ORGANISM: CHICKEN (B) INDIVIDUAL ISOLATE: e9-e14 embryos brains, adult brains (vii) IMMEDIATE SOURCE: (A) LIBRARY: many lambda GT11 cDNA and genomic libraries (B) CLONE: synthesis of 14 clones (x) PUBLICATION INFORMATION: (A) AUTHORS: Burgoon, M.P. Grumet, M. Mauro, V. Edelman, G.M. Cunningham, B.A. (B) TITLE: Structure of the chicken neuron- glial cell adhesion molecule, Ng-CAM: Origin of the polypeptides and relation to the Ig superfamily. (C) JOURNAL: J. Cell Biol. (D) VOLUME: 112 (E) ISSUE: (F) PAGES: 1017-1029 (G) DATE: 1991 (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 35: ArgAsnProGlyGlyValHisGlyGluGlyAsnGluThrGlyAsnLeuVal 151015 IleThrTrpGluProLeuProProGlnAlaTrpAsnAlaProTrpAlaArg 202530 TyrArgValGlnTrpArgProLeuGluGluProGlyGlyGlyGlyProSer 35404550 GlyGlyPheProTrpAlaGluSerThrValAspAlaProProValValVal 556065 GlyGlyLeuProProPheSerProPheGlnIleArgValGlnAlaValAsn 70758085 GlyAlaGlyLysGlyProGluAlaThrProGlyValGlyHisSerGlyGlu 9095100 AspLeu (2) INFORMATION FOR SEQ ID NO:36: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 126 (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: amino acids (iii) HYPOTHETICAL: irrelevant (iv) ANTI-SENSE: no (vi) ORIGINAL SOURCE: (A) ORGANISM: CHICKEN (B) INDIVIDUAL ISOLATE: e9-e14 embryos brains, adult brains (vii) IMMEDIATE SOURCE: (A) LIBRARY: many lambda GT11 cDNA and genomic libraries (B) CLONE: synthesis of 14 clones (x) PUBLICATION INFORMATION: (A) AUTHORS: Burgoon, M.P. Grumet, M. Mauro, V. Edelman, G.M. Cunningham, B.A. (B) TITLE: Structure of the chicken neuron- glial cell adhesion molecule, Ng-CAM: Origin of the polypeptides and relation to the Ig superfamily. (C) JOURNAL: J. Cell Biol. (D) VOLUME: 112 (E) ISSUE: (F) PAGES: 1017-1029 (G) DATE: 1991 (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 36: ProLeuValTyrProGluAsnValGlyValGluLeuLeuAsnSerSerThr 151015 ValArgValArgTrpThrLeuGlyGlyGlyProLysGluLeuArgGlyArg 202530 LeuArgGlyPheArgValLeuTyrTrpArgLeuGlyTrpValGlyGluArg 35404550 SerArgArgGlnAlaProProAspProProGlnIleProGlnSerProAla 556065 GluAspProProProPheProProValAlaLeuThrValGlyGlyAspAla 70758085 ArgGlyAlaLeuLeuGlyGlyLeuArgProTrpSerArgTyrGlnLeuArg 9095100 ValLeuValPheAsnGlyArgGlyAspGlyProProSerGluProIleAla 105110115 PheGluThrProGluGlyVal 120125 (2) INFORMATION FOR SEQ ID NO:37: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 98 (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: amino acids (iii) HYPOTHETICAL: irrelevant (iv) ANTI-SENSE: no (vi) ORIGINAL SOURCE: (A) ORGANISM: CHICKEN (B) INDIVIDUAL ISOLATE: e9-e14 embryos brains, adult brains (vii) IMMEDIATE SOURCE: (A) LIBRARY: many lambda GT11 cDNA and genomic libraries (B) CLONE: synthesis of 14 clones (x) PUBLICATION INFORMATION: (A) AUTHORS: Burgoon, M.P. Grumet, M. Mauro, V. Edelman, G.M. Cunningham, B.A. (B) TITLE: Structure of the chicken neuron- glial cell adhesion molecule, Ng-CAM: Origin of the polypeptides and relation to the Ig superfamily. (C) JOURNAL: J. Cell Biol. (D) VOLUME: 112 (E) ISSUE: (F) PAGES: 1017-1029 (G) DATE: 1991 (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 37: ProGlyProProGluGluLeuArgValGluArgLeuAspAspThrAlaLeu 151015 SerValValGluArgArgThrPheLysArgSerIleThrGlyTyrValLeu

202530 ArgTyrGlnGlnValGluProGlySerAlaLeuProGlyGlySerValLeu 35404550 ArgAspProGlnCysAspLeuArgGlyLeuAsnAlaArgSerArgTyrArg 556065 LeuAlaLeuProSerThrProArgGluArgProAlaLeuGlnThrValGly 70758085 SerThrLysProGluProProSerProLeuTrpSerArg 9095 (2) INFORMATION FOR SEQ ID NO:38: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 93 (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: amino acids (iii) HYPOTHETICAL: irrelevant (iv) ANTI-SENSE: no (vi) ORIGINAL SOURCE: (A) ORGANISM: CHICKEN (B) INDIVIDUAL ISOLATE: e9-e14 embryos brains, adult brains (vii) IMMEDIATE SOURCE: (A) LIBRARY: many lambda GT11 cDNA and genomic libraries (B) CLONE: synthesis of 14 clones (x) PUBLICATION INFORMATION: (A) AUTHORS: Burgoon, M.P. Grumet, M. Mauro, V. Edelman, G.M. Cunningham, B.A. (B) TITLE: Structure of the chicken neuron- glial cell adhesion molecule, Ng-CAM: Origin of the polypeptides and relation to the Ig superfamily. (C) JOURNAL: J. Cell Biol. (D) VOLUME: 112 (E) ISSUE: (F) PAGES: 1017-1029 (G) DATE: 1991 (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 38: PheGlyValGlyGlyArgGlyGlyPheHisGlyAlaAlaValGluPheGly 151015 AlaAlaGlnGluAspAspValGluPheGluValGlnPheMetAsnLysSer 202530 ThrAspGluProTrpArgThrSerGlyArgAlaAsnSerSerLeuArgArg 35404550 TyrArgLeuGluGlyLeuArgProGlyThrAlaTyrArgValGlnPheVal 556065 GlyArgAsnArgSerGlyGluAsnValAlaPheTrpGluSerGluValGln 70758085 ThrAsnGlyThrValValProGln 90 (2) INFORMATION FOR SEQ ID NO:39: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 144 (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: amino acids (iii) HYPOTHETICAL: irrelevant (iv) ANTI-SENSE: no (vi) ORIGINAL SOURCE: (A) ORGANISM: CHICKEN (B) INDIVIDUAL ISOLATE: e9-e14 embryos brains, adult brains (vii) IMMEDIATE SOURCE: (A) LIBRARY: many lambda GT11 cDNA and genomic libraries (B) CLONE: synthesis of 14 clones (x) PUBLICATION INFORMATION: (A) AUTHORS: Burgoon, M.P. Grumet, M. Mauro, V. Edelman, G.M. Cunningham, B.A. (B) TITLE: Structure of the chicken neuron- glial cell adhesion molecule, Ng-CAM: Origin of the polypeptides and relation to the Ig superfamily. (C) JOURNAL: J. Cell Biol. (D) VOLUME: 112 (E) ISSUE: (F) PAGES: 1017-1029 (G) DATE: 1991 (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 39: ProGlyGlyGlyValCysThrLysGlyTrpPheIleGlyPheValSerSer 151015 ValValLeuLeuLeuLeuIleLeuLeuIleLeuCysPheIleLysArgSer 202530 LysGlyGlyLysTyrSerValLysAspLysGluAspThrGlnValAspSer 35404550 GluAlaArgProMetLysAspGluThrPheGlyGluTyrArgSerLeuGlu 556065 SerGluAlaGluLysGlySerAlaSerGlySerGlyAlaGlySerGlyVal 70758085 GlySerProGlyArgGlyProCysAlaAlaGlySerGluAspSerLeuAla 9095100 GlyTyrGlyGlySerGlyAspValGlnPheAsnGluAspGlySerPheIle 105110115 GlyGlnTyrArgGlyProGlyAlaGlyProGlySerSerGlyProAlaSer 120125130135 ProCysAlaGlyProProLeuAsp 140 __________________________________________________________________________

* * * * *

---